Transcript: Human XR_931513.1

PREDICTED: Homo sapiens IQ motif and Sec7 domain ArfGEF 3 (IQSEC3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQSEC3 (440073)
Length:
4349
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931513.1
NBCI Gene record:
IQSEC3 (440073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147813 GCTCTTTGAGAACGAGTATTA pLKO.1 2880 3UTR 100% 13.200 18.480 N IQSEC3 n/a
2 TRCN0000179835 CGAGTATTACTCTCATGGCAT pLKO.1 2892 3UTR 100% 2.640 2.112 N IQSEC3 n/a
3 TRCN0000239124 GAACTCTCCCTTGACCTAAAG pLKO_005 961 3UTR 100% 10.800 7.560 N Iqsec3 n/a
4 TRCN0000180343 GAAGTCCATTGTGGGCATGAA pLKO.1 2646 3UTR 100% 4.950 3.465 N IQSEC3 n/a
5 TRCN0000180674 GCTCAGCAAGAACTTCGAGAA pLKO.1 1077 3UTR 100% 4.050 2.835 N IQSEC3 n/a
6 TRCN0000180949 GAGGACTTCATCCGAAACCTT pLKO.1 2506 3UTR 100% 3.000 2.100 N IQSEC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.