Transcript: Human XR_931745.2

PREDICTED: Homo sapiens lactamase beta (LACTB), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LACTB (114294)
Length:
2046
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931745.2
NBCI Gene record:
LACTB (114294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296666 TGTAGAAAGCAACGGCATTAT pLKO_005 1571 3UTR 100% 13.200 18.480 N LACTB n/a
2 TRCN0000296726 CCTTAACACCATAGGTGCAAA pLKO_005 1793 3UTR 100% 4.950 6.930 N LACTB n/a
3 TRCN0000046625 CCTTACGTGGATAACTCCTAT pLKO.1 1304 3UTR 100% 4.950 3.960 N LACTB n/a
4 TRCN0000296665 ACTGGATACAGAGACTATAAA pLKO_005 1651 3UTR 100% 15.000 10.500 N LACTB n/a
5 TRCN0000313301 TACGTGGATAACTCCTATAAA pLKO_005 1307 3UTR 100% 15.000 10.500 N Lactb n/a
6 TRCN0000046624 CTTTGAAGATTGCCCTTGAAT pLKO.1 1746 3UTR 100% 5.625 3.938 N LACTB n/a
7 TRCN0000046623 GCAGGGAAACTGGATCTTGAT pLKO.1 604 3UTR 100% 4.950 3.465 N LACTB n/a
8 TRCN0000290580 GCAGGGAAACTGGATCTTGAT pLKO_005 604 3UTR 100% 4.950 3.465 N LACTB n/a
9 TRCN0000046626 CCGGGCATAGTGGTTGGAGTT pLKO.1 439 3UTR 100% 1.350 0.945 N LACTB n/a
10 TRCN0000046627 CAAACCAGAAACAATGGTTAT pLKO.1 1450 3UTR 100% 1.080 0.756 N LACTB n/a
11 TRCN0000296674 TTGGGATAAAGAGGGTAAATA pLKO_005 1504 3UTR 100% 15.000 9.000 N LACTB n/a
12 TRCN0000221957 CTGTCACAACAAGATTACTAA pLKO.1 686 3UTR 100% 5.625 7.875 N Lactb n/a
13 TRCN0000312337 CTGTCACAACAAGATTACTAA pLKO_005 686 3UTR 100% 5.625 7.875 N Lactb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04656 pDONR223 100% 80.2% None 1_66del;1182_1260del;1787_2046del n/a
2 ccsbBroad304_04656 pLX_304 0% 80.2% V5 1_66del;1182_1260del;1787_2046del n/a
3 TRCN0000480410 GCAGCTGGGACCTGCCTGCAGTCG pLX_317 25.3% 80.2% V5 1_66del;1182_1260del;1787_2046del n/a
Download CSV