Transcript: Human XR_931796.2

PREDICTED: Homo sapiens solute carrier organic anion transporter family member 3A1 (SLCO3A1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLCO3A1 (28232)
Length:
2675
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931796.2
NBCI Gene record:
SLCO3A1 (28232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079257 GCGGTCTTCATTGACACAAGT pLKO.1 817 3UTR 100% 4.950 6.930 N Slco3a1 n/a
2 TRCN0000043264 CGGTCTTCATTGACACAAGTA pLKO.1 818 3UTR 100% 4.950 3.960 N SLCO3A1 n/a
3 TRCN0000307638 CGGTCTTCATTGACACAAGTA pLKO_005 818 3UTR 100% 4.950 3.960 N SLCO3A1 n/a
4 TRCN0000296814 TGTTCACGATGCTGGTATTTG pLKO_005 743 3UTR 100% 13.200 9.240 N SLCO3A1 n/a
5 TRCN0000043263 CCTGCAATAATAACTGTGAAT pLKO.1 1499 3UTR 100% 4.950 3.465 N SLCO3A1 n/a
6 TRCN0000043267 CTGGGCTCTTTCTGTACCAAA pLKO.1 784 3UTR 100% 4.950 3.465 N SLCO3A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08091 pDONR223 100% 73.3% None (many diffs) n/a
2 ccsbBroad304_08091 pLX_304 0% 73.3% V5 (many diffs) n/a
3 TRCN0000477005 GATGTGAAGCCACAGACAAATGGC pLX_317 16.7% 73.3% V5 (many diffs) n/a
Download CSV