Transcript: Human XR_931800.2

PREDICTED: Homo sapiens one cut homeobox 1 (ONECUT1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ONECUT1 (3175)
Length:
2603
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931800.2
NBCI Gene record:
ONECUT1 (3175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084172 AGGTCAGCAATGGAAGTAATT pLKO.1 1214 3UTR 100% 13.200 9.240 N Onecut1 n/a
2 TRCN0000416074 ACCCTGGAGCAAACTCAAATC pLKO_005 1383 3UTR 100% 10.800 7.560 N ONECUT1 n/a
3 TRCN0000084169 GCAGGTCAGCAATGGAAGTAA pLKO.1 1212 3UTR 100% 5.625 3.938 N Onecut1 n/a
4 TRCN0000014965 GCCTCCATGAATAACCTCTAT pLKO.1 853 3UTR 100% 4.950 3.465 N ONECUT1 n/a
5 TRCN0000014967 TGGAAGTAATTCAGGGCAGAT pLKO.1 1224 3UTR 100% 4.050 2.430 N ONECUT1 n/a
6 TRCN0000412311 GTATCACCACCGAGCTCAAAC pLKO_005 1277 3UTR 100% 10.800 15.120 N Onecut1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 178 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931800.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00764 pDONR223 100% 50.1% None (many diffs) n/a
2 ccsbBroad304_00764 pLX_304 0% 50.1% V5 (many diffs) n/a
3 TRCN0000476801 TTGGTATAAGCAGGCAATCCGTTA pLX_317 25.9% 50.1% V5 (many diffs) n/a
Download CSV