Transcript: Human XR_931875.3

PREDICTED: Homo sapiens immunoglobulin superfamily containing leucine rich repeat 2 (ISLR2), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ISLR2 (57611)
Length:
2133
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931875.3
NBCI Gene record:
ISLR2 (57611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931875.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146567 CACAACTTCATATCCAGCTTT pLKO.1 660 3UTR 100% 4.950 6.930 N ISLR2 n/a
2 TRCN0000414653 CTTAGTCTGTCCGCGAACAAG pLKO_005 504 3UTR 100% 4.950 6.930 N ISLR2 n/a
3 TRCN0000179714 GCAACTCTATCACAATCCCTT pLKO.1 866 3UTR 100% 2.640 3.696 N ISLR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931875.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03836 pDONR223 100% 63.2% None (many diffs) n/a
2 ccsbBroad304_03836 pLX_304 0% 63.2% V5 (many diffs) n/a
3 TRCN0000477821 GCCTGAATCCTAGTTCCCCTCACC pLX_317 15.3% 63.2% V5 (many diffs) n/a
Download CSV