Transcript: Human XR_931899.2

PREDICTED: Homo sapiens tumor protein p53 binding protein 1 (TP53BP1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TP53BP1 (7158)
Length:
3879
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931899.2
NBCI Gene record:
TP53BP1 (7158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218999 GATACTCCTTGCCTGATAATT pLKO_005 174 3UTR 100% 15.000 10.500 N TP53BP1 n/a
2 TRCN0000229638 AGAACGAGGAGACGGTAATAG pLKO_005 341 3UTR 100% 13.200 9.240 N TP53BP1 n/a
3 TRCN0000229639 CAGTACTCCTATTGGTATTAG pLKO_005 2936 3UTR 100% 13.200 9.240 N TP53BP1 n/a
4 TRCN0000218980 GATGCTAATACTGCAATTAAG pLKO_005 759 3UTR 100% 13.200 9.240 N TP53BP1 n/a
5 TRCN0000018866 CCAGTGTGATTAGTATTGATT pLKO.1 2287 3UTR 100% 5.625 3.938 N TP53BP1 n/a
6 TRCN0000018869 CCCTTGTTCAGGACAGTCTTT pLKO.1 1174 3UTR 100% 4.950 3.465 N TP53BP1 n/a
7 TRCN0000321586 TGCCTAAAGAAGGTGATATTA pLKO_005 2851 3UTR 100% 15.000 12.000 N Trp53bp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465716 CCCGCTAGCACTCTAGGATCTGGA pLX_317 5.5% 62% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV