Transcript: Human XR_934022.2

PREDICTED: Homo sapiens acyl-CoA dehydrogenase very long chain (ACADVL), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACADVL (37)
Length:
2098
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934022.2
NBCI Gene record:
ACADVL (37)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245177 CGGTAGATCATGCCACTAATC pLKO_005 1135 3UTR 100% 10.800 15.120 N ACADVL n/a
2 TRCN0000245178 TTCGCATCTTCCGGATCTTTG pLKO_005 1423 3UTR 100% 10.800 15.120 N ACADVL n/a
3 TRCN0000221898 GCCACTAATCGTACCCAGTTT pLKO.1 1146 3UTR 100% 4.950 6.930 N ACADVL n/a
4 TRCN0000221900 CAAGGCGGAATCTAAGTCCTT pLKO.1 257 3UTR 100% 2.640 3.696 N ACADVL n/a
5 TRCN0000221896 GCAGTATGTAACTGAGTCCAT pLKO.1 1226 3UTR 100% 2.640 3.696 N ACADVL n/a
6 TRCN0000245175 CAGACATCTTCACGGTCTTTG pLKO_005 826 3UTR 100% 10.800 7.560 N ACADVL n/a
7 TRCN0000221897 GCAGACATCTTCACGGTCTTT pLKO.1 825 3UTR 100% 4.950 3.465 N ACADVL n/a
8 TRCN0000245179 AGTTATGTGCCTTCCCTCAAG pLKO_005 1954 3UTR 100% 4.050 2.835 N ACADVL n/a
9 TRCN0000221899 GAGGTGTTCTTTGATGGAGTA pLKO.1 984 3UTR 100% 4.050 2.835 N ACADVL n/a
10 TRCN0000245176 GTACCATGAGAGGCATCATTG pLKO_005 1108 3UTR 100% 0.000 0.000 N ACADVL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00007 pDONR223 100% 85% None 1_59del;1492_1493ins98;1927_2098del n/a
2 ccsbBroad304_00007 pLX_304 0% 85% V5 1_59del;1492_1493ins98;1927_2098del n/a
3 TRCN0000479329 GTGTCCAAAATTAAGTGTATACCT pLX_317 20.9% 85% V5 1_59del;1492_1493ins98;1927_2098del n/a
Download CSV