Transcript: Human XR_934068.2

PREDICTED: Homo sapiens phosphoribosyl pyrophosphate synthetase associated protein 2 (PRPSAP2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRPSAP2 (5636)
Length:
1177
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934068.2
NBCI Gene record:
PRPSAP2 (5636)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045470 GCAGGTTTACCAGGAACCTAA pLKO.1 357 3UTR 100% 0.495 0.347 N PRPSAP2 n/a
2 TRCN0000045472 ACCAAGATGAACATAACCAAA pLKO.1 241 3UTR 100% 4.950 2.970 N PRPSAP2 n/a
3 TRCN0000315751 ACCAAGATGAACATAACCAAA pLKO_005 241 3UTR 100% 4.950 2.970 N PRPSAP2 n/a
4 TRCN0000078827 CCCTGAAGGAAAGAGGTGCAT pLKO.1 1159 3UTR 100% 2.640 1.584 N Gm13651 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01300 pDONR223 100% 61.4% None 1_210del;944_1041del;1177_1178ins238 n/a
2 TRCN0000479876 ACGGCGACACATCCAGGGGTGCCG pLX_317 33.1% 61.4% V5 1_210del;944_1041del;1177_1178ins238 n/a
Download CSV