Transcript: Human XR_934346.3

PREDICTED: Homo sapiens gap junction protein gamma 1 (GJC1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GJC1 (10052)
Length:
1733
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934346.3
NBCI Gene record:
GJC1 (10052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934346.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060287 CGAGACTCACTAAACAGTAAA pLKO.1 1045 3UTR 100% 13.200 18.480 N GJC1 n/a
2 TRCN0000060286 CCATCTATTACGATGAGCAAA pLKO.1 395 3UTR 100% 4.950 6.930 N GJC1 n/a
3 TRCN0000060285 CGGGTGCTTATAATTATCCTT pLKO.1 1085 3UTR 100% 3.000 4.200 N GJC1 n/a
4 TRCN0000068640 CCTCATAAGATAGACTGCTTT pLKO.1 913 3UTR 100% 4.950 3.960 N Gjc1 n/a
5 TRCN0000428105 AGACCTCCGTCTGGATTTAAT pLKO_005 1442 3UTR 100% 15.000 10.500 N GJC1 n/a
6 TRCN0000438291 CCCTATGCAATGCGCTGGAAA pLKO_005 616 3UTR 100% 4.950 3.465 N GJC1 n/a
7 TRCN0000060284 GCAGACTTCCTTGTCCTCATA pLKO.1 899 3UTR 100% 4.950 3.465 N GJC1 n/a
8 TRCN0000060283 GCTATCCACAAGATTGCCAAA pLKO.1 553 3UTR 100% 4.050 2.835 N GJC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934346.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07538 pDONR223 100% 68.3% None (many diffs) n/a
2 ccsbBroad304_07538 pLX_304 0% 68.3% V5 (many diffs) n/a
Download CSV