Transcript: Human XR_934439.3

PREDICTED: Homo sapiens apoptosis antagonizing transcription factor (AATF), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AATF (26574)
Length:
1947
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934439.3
NBCI Gene record:
AATF (26574)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274387 TTGACTCAGATCGACCATATT pLKO_005 1234 3UTR 100% 13.200 9.240 N AATF n/a
2 TRCN0000285201 ATGGAGGAAACCAGTGACTTT pLKO_005 1797 3UTR 100% 4.950 3.465 N AATF n/a
3 TRCN0000017388 CACTTCAGAAATGGCACGATA pLKO.1 1154 3UTR 100% 4.950 3.465 N AATF n/a
4 TRCN0000017389 CGCTCTGTCTATCGAGTTCTT pLKO.1 1297 3UTR 100% 4.950 3.465 N AATF n/a
5 TRCN0000017390 GCCAGGGTGATTGACAGGTTT pLKO.1 272 3UTR 100% 4.950 3.465 N AATF n/a
6 TRCN0000017392 GCTCTTGGAAGGAAGGATCAA pLKO.1 880 3UTR 100% 4.950 3.465 N AATF n/a
7 TRCN0000274386 GCTCTTGGAAGGAAGGATCAA pLKO_005 880 3UTR 100% 4.950 3.465 N AATF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08028 pDONR223 100% 75.8% None (many diffs) n/a
2 ccsbBroad304_08028 pLX_304 0% 75.8% V5 (many diffs) n/a
3 TRCN0000468401 TCCCAACAATTTTAATTGTCCACC pLX_317 19.5% 75.8% V5 (many diffs) n/a
Download CSV