Transcript: Human XR_934463.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 3 (MAP3K3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K3 (4215)
Length:
2353
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934463.1
NBCI Gene record:
MAP3K3 (4215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002308 AGGAATACTCAGATCGGGAAA pLKO.1 1411 3UTR 100% 4.050 5.670 N MAP3K3 n/a
2 TRCN0000002305 CGGCCTGTGAAATATGAAGAT pLKO.1 828 3UTR 100% 4.950 3.960 N MAP3K3 n/a
3 TRCN0000197088 GCGTCATCAAGGCAACTTGTT pLKO.1 1541 3UTR 100% 4.950 3.960 N MAP3K3 n/a
4 TRCN0000219662 TGATTGTTCACCGGGACATTA pLKO.1 2204 3UTR 100% 13.200 9.240 N MAP3K3 n/a
5 TRCN0000219661 TGCCTTCGGCAGGGTCTATTT pLKO.1 1757 3UTR 100% 13.200 9.240 N MAP3K3 n/a
6 TRCN0000002306 GTGCGAGATCCAGTTGCTAAA pLKO.1 1983 3UTR 100% 10.800 7.560 N MAP3K3 n/a
7 TRCN0000010692 ACCTCTTGATCTACATTACAT pLKO.1 881 3UTR 100% 5.625 3.938 N MAP3K3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488899 GACAAGATGAGCCTCATCCCAAGT pLX_317 15.7% 60.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491400 TGTGGCCGAGCCGACTATATAGAA pLX_317 15.6% 60.3% V5 (many diffs) n/a
Download CSV