Transcript: Human XR_936180.3

PREDICTED: Homo sapiens myosin IF (MYO1F), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO1F (4542)
Length:
2434
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_936180.3
NBCI Gene record:
MYO1F (4542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_936180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157058 GAGCGAAAGTTCGATGGCTTT pLKO.1 2215 3UTR 100% 4.050 5.670 N MYO1F n/a
2 TRCN0000152449 CAACAGCATCAATCGGAACTT pLKO.1 2343 3UTR 100% 4.950 3.465 N MYO1F n/a
3 TRCN0000156636 GCTCTGTGCTCATCTCTGTAA pLKO.1 285 3UTR 100% 4.950 3.465 N MYO1F n/a
4 TRCN0000156838 GTGGATGACATGGTGCTTCTT pLKO.1 188 3UTR 100% 4.950 3.465 N MYO1F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_936180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01048 pDONR223 100% 66.4% None 1_133del;2030_2043del;2434_2435ins1007 n/a
2 ccsbBroad304_01048 pLX_304 0% 66.4% V5 1_133del;2030_2043del;2434_2435ins1007 n/a
3 TRCN0000468331 TCTTCATGACGGATTGAACCCCCT pLX_317 12.8% 66.4% V5 1_133del;2030_2043del;2434_2435ins1007 n/a
Download CSV