Transcript: Human XR_936513.2

PREDICTED: Homo sapiens endothelin 3 (EDN3), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EDN3 (1908)
Length:
1165
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_936513.2
NBCI Gene record:
EDN3 (1908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_936513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117876 CCTATGGACTGTCCAACTACA pLKO.1 774 3UTR 100% 4.950 6.930 N EDN3 n/a
2 TRCN0000117875 GTAATTCAAGGACGGCAGAAA pLKO.1 939 3UTR 100% 4.950 6.930 N EDN3 n/a
3 TRCN0000372111 TGCACGTGCTTCACCTACAAG pLKO_005 686 3UTR 100% 4.950 3.960 N EDN3 n/a
4 TRCN0000117874 ACAAGGAGTGTGTCTACTATT pLKO.1 708 3UTR 100% 13.200 9.240 N EDN3 n/a
5 TRCN0000117873 GTTGAAGTCAAGGACCAACAA pLKO.1 1079 3UTR 100% 4.950 3.465 N EDN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_936513.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00479 pDONR223 100% 56% None 1_397del;984_1076del;1165_1166ins39 n/a
2 ccsbBroad304_00479 pLX_304 0% 56% V5 1_397del;984_1076del;1165_1166ins39 n/a
3 TRCN0000467255 GGCCCACATTTACCTATTGACTTG pLX_317 67.8% 56% V5 1_397del;984_1076del;1165_1166ins39 n/a
Download CSV