Transcript: Human XR_937111.2

PREDICTED: Homo sapiens Ral GTPase activating protein catalytic alpha subunit 2 (RALGAPA2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RALGAPA2 (57186)
Length:
9866
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_937111.2
NBCI Gene record:
RALGAPA2 (57186)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_937111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264207 GACCGAACCGATGCGATTTAG pLKO_005 2273 3UTR 100% 13.200 18.480 N RALGAPA2 n/a
2 TRCN0000264209 TAAACGAGTGGGCCAACATTA pLKO_005 2068 3UTR 100% 13.200 18.480 N RALGAPA2 n/a
3 TRCN0000264210 TACGGGATAATCTAGCAATAA pLKO_005 3202 3UTR 100% 13.200 18.480 N RALGAPA2 n/a
4 TRCN0000282944 ACTTGTCATCCACGGATTATG pLKO_005 4270 3UTR 100% 13.200 9.240 N RALGAPA2 n/a
5 TRCN0000264208 GGACTCAAACTAGGCTGTATC pLKO_005 6442 3UTR 100% 10.800 7.560 N RALGAPA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_937111.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14227 pDONR223 100% 7.2% None 1_5135del;5848_9866del n/a
2 ccsbBroad304_14227 pLX_304 0% 7.2% V5 (not translated due to frame shift) 1_5135del;5848_9866del n/a
3 TRCN0000467052 AACGGTAAACGTGCGTAGCCTCTG pLX_317 64.2% 7.2% V5 (not translated due to prior stop codon) 1_5135del;5848_9866del n/a
Download CSV