Transcript: Human XR_937809.3

PREDICTED: Homo sapiens EMI domain containing 1 (EMID1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EMID1 (129080)
Length:
1630
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_937809.3
NBCI Gene record:
EMID1 (129080)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_937809.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296032 TACGCGAGGCTTTGAAGATTT pLKO_005 1476 3UTR 100% 13.200 18.480 N EMID1 n/a
2 TRCN0000117091 CCGCACCATCTCATGCCATGT pLKO.1 251 3UTR 100% 1.350 1.080 N EMID1 n/a
3 TRCN0000288919 CCGCACCATCTCATGCCATGT pLKO_005 251 3UTR 100% 1.350 1.080 N EMID1 n/a
4 TRCN0000296033 TGACCATGCTGACTGTCATAG pLKO_005 592 3UTR 100% 10.800 7.560 N EMID1 n/a
5 TRCN0000117089 ACCCACATACAAGGTGATGTA pLKO.1 359 3UTR 100% 4.950 3.465 N EMID1 n/a
6 TRCN0000288918 ACCCACATACAAGGTGATGTA pLKO_005 359 3UTR 100% 4.950 3.465 N EMID1 n/a
7 TRCN0000117088 GAAACAATGATTGGGCTCTAT pLKO.1 1520 3UTR 100% 4.950 3.465 N EMID1 n/a
8 TRCN0000197917 GAAACAATGATTGGGCTCTAT pLKO.1 1520 3UTR 100% 4.950 3.465 N Emid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_937809.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09520 pDONR223 100% 74.8% None (many diffs) n/a
2 ccsbBroad304_09520 pLX_304 0% 74.8% V5 (many diffs) n/a
3 TRCN0000472939 TGCCGCAGGGCTCACCCAATTTGA pLX_317 14.9% 74.8% V5 (many diffs) n/a
Download CSV