Transcript: Human XR_938547.1

PREDICTED: Homo sapiens solute carrier family 25 member 43 (SLC25A43), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A43 (203427)
Length:
936
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_938547.1
NBCI Gene record:
SLC25A43 (203427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_938547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044690 CCGCAAATTTGTTGTGCTGTT pLKO.1 348 3UTR 100% 4.050 5.670 N SLC25A43 n/a
2 TRCN0000437955 CAGATGACCTGGGCCACATTT pLKO_005 371 3UTR 100% 13.200 9.240 N SLC25A43 n/a
3 TRCN0000044692 CTCCCACAGAACTTTGCTAAT pLKO.1 679 3UTR 100% 10.800 7.560 N SLC25A43 n/a
4 TRCN0000424686 GGAGGAGTAGATGTCCATTTC pLKO_005 882 3UTR 100% 10.800 7.560 N SLC25A43 n/a
5 TRCN0000044691 CCACCATTGTAACATATCCTA pLKO.1 437 3UTR 100% 3.000 2.100 N SLC25A43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_938547.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09828 pDONR223 100% 65% None 1_78del;767_852del;936_937ins251 n/a
2 ccsbBroad304_09828 pLX_304 0% 65% V5 1_78del;767_852del;936_937ins251 n/a
3 TRCN0000465781 CCCGCTCTGTGTCGGCCCGTCTAC pLX_317 22.2% 65% V5 1_78del;767_852del;936_937ins251 n/a
Download CSV