Transcript: Human XR_938729.2

PREDICTED: Homo sapiens coiled-coil domain containing 158 (CCDC158), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC158 (339965)
Length:
3232
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_938729.2
NBCI Gene record:
CCDC158 (339965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_938729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263521 CCGGACAGAGCGTGATCAATT pLKO_005 1363 3UTR 100% 13.200 18.480 N CCDC158 n/a
2 TRCN0000263522 CATCTATTCGTGGTACAATAA pLKO_005 375 3UTR 100% 13.200 10.560 N CCDC158 n/a
3 TRCN0000263518 GATAGGATTGAGCAGTTAATA pLKO_005 1079 3UTR 100% 15.000 10.500 N CCDC158 n/a
4 TRCN0000263520 CAGCTTGGGCTCAGCTATTAG pLKO_005 928 3UTR 100% 13.200 9.240 N CCDC158 n/a
5 TRCN0000263519 ATAGGGTAAGAGATTGCATTA pLKO_005 3153 3UTR 100% 10.800 7.560 N CCDC158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_938729.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13593 pDONR223 100% 20.8% None 1_280del;884delA;957_3232del n/a
2 ccsbBroad304_13593 pLX_304 0% 20.8% V5 1_280del;884delA;957_3232del n/a
3 TRCN0000475208 ACTTTGATCTAAAATTGAACCTTC pLX_317 52.3% 20.8% V5 1_280del;884delA;957_3232del n/a
Download CSV