Transcript: Human XR_940407.1

PREDICTED: Homo sapiens ALS2 C-terminal like (ALS2CL), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALS2CL (259173)
Length:
5034
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940407.1
NBCI Gene record:
ALS2CL (259173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421701 ACTGCCGCTGCGCAGAATATA pLKO_005 1209 3UTR 100% 15.000 21.000 N ALS2CL n/a
2 TRCN0000427574 ATTGCCAACTTGAGCCTCTTT pLKO_005 2564 3UTR 100% 4.950 6.930 N ALS2CL n/a
3 TRCN0000421922 TGACAGAGGTGAGCGCTACAT pLKO_005 1624 3UTR 100% 4.950 6.930 N ALS2CL n/a
4 TRCN0000435755 TCACGCTGACGAGCAATCAGA pLKO_005 2646 3UTR 100% 3.000 4.200 N ALS2CL n/a
5 TRCN0000424949 TTTAGTCTGCTGGGCTGTATT pLKO_005 3661 3UTR 100% 13.200 10.560 N ALS2CL n/a
6 TRCN0000078729 CCCGAAGAAGAGTTCTCCTTT pLKO.1 1061 3UTR 100% 4.950 3.960 N ALS2CL n/a
7 TRCN0000432267 GCCACTAGCCCATCTTCAATG pLKO_005 3449 3UTR 100% 10.800 7.560 N ALS2CL n/a
8 TRCN0000078732 GCTGCGTAGGTCTCAGGATTA pLKO.1 2089 3UTR 100% 10.800 7.560 N ALS2CL n/a
9 TRCN0000433418 TGAACGCAGTCACCCTCTTTG pLKO_005 753 3UTR 100% 10.800 7.560 N ALS2CL n/a
10 TRCN0000427435 CACAATGTCCACACCTTTGAT pLKO_005 983 3UTR 100% 5.625 3.938 N ALS2CL n/a
11 TRCN0000078730 CAGGCCCACATAGAGTACATT pLKO.1 482 3UTR 100% 5.625 3.938 N ALS2CL n/a
12 TRCN0000078728 CGCTGTAAAGGACCTTCCATT pLKO.1 3602 3UTR 100% 4.950 3.465 N ALS2CL n/a
13 TRCN0000078731 CTGAGGACAAGTTCGACTGTT pLKO.1 1398 3UTR 100% 4.950 3.465 N ALS2CL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940407.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.