Transcript: Human XR_940496.2

PREDICTED: Homo sapiens SH3 and cysteine rich domain (STAC), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAC (6769)
Length:
1007
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940496.2
NBCI Gene record:
STAC (6769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136585 CCACATGATAGTGGGAACAAA pLKO.1 557 3UTR 100% 5.625 7.875 N STAC n/a
2 TRCN0000138789 GACCAAGAGTTTACGGAGCAA pLKO.1 326 3UTR 100% 2.640 3.696 N STAC n/a
3 TRCN0000426287 GAACAGTTTGGCTGCATTAAA pLKO_005 717 3UTR 100% 15.000 10.500 N STAC n/a
4 TRCN0000138152 CCACTTTCTGTGATGTCTGCA pLKO.1 535 3UTR 100% 2.640 1.848 N STAC n/a
5 TRCN0000134576 GCATTAAAGAAGTTATGCCCA pLKO.1 730 3UTR 100% 0.660 0.462 N STAC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07007 pDONR223 100% 37.9% None (many diffs) n/a
2 ccsbBroad304_07007 pLX_304 0% 37.9% V5 (many diffs) n/a
3 TRCN0000492333 ACCAGCCGCGCTTCTGCTGAAATT pLX_317 34.9% 37.9% V5 (many diffs) n/a
Download CSV