Transcript: Human XR_940528.1

PREDICTED: Homo sapiens exo/endonuclease G (EXOG), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOG (9941)
Length:
894
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940528.1
NBCI Gene record:
EXOG (9941)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049857 CTTTGACCTTACCTCAGACTA pLKO.1 638 3UTR 100% 4.950 6.930 N EXOG n/a
2 TRCN0000049854 GCCTTCAATGAAGATTATGTT pLKO.1 421 3UTR 100% 5.625 4.500 N EXOG n/a
3 TRCN0000431790 GATGGGTTCTTGAACATATTT pLKO_005 320 3UTR 100% 15.000 10.500 N EXOG n/a
4 TRCN0000431664 TTTAAGCCTGATCCCAATATC pLKO_005 385 3UTR 100% 13.200 9.240 N EXOG n/a
5 TRCN0000425108 TATTGGAACAGAATAGAAATG pLKO_005 565 3UTR 100% 10.800 7.560 N EXOG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11435 pDONR223 100% 24.7% None 1_465del;691_806del;894_895ins371 n/a
2 ccsbBroad304_11435 pLX_304 0% 24.7% V5 1_465del;691_806del;894_895ins371 n/a
3 TRCN0000468541 GTACTCTCGCCCATACTTCCATAC pLX_317 60.1% 24.7% V5 1_465del;691_806del;894_895ins371 n/a
Download CSV