Transcript: Human XR_942393.3

PREDICTED: Homo sapiens SNF2 histone linker PHD RING helicase (SHPRH), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHPRH (257218)
Length:
5006
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_942393.3
NBCI Gene record:
SHPRH (257218)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_942393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235922 ACGGAACCAGAAGCGCTATAT pLKO_005 2546 3UTR 100% 13.200 18.480 N SHPRH n/a
2 TRCN0000015554 CCGCCTGTTCTTCATATCATT pLKO.1 4281 3UTR 100% 5.625 7.875 N SHPRH n/a
3 TRCN0000015557 GCACTACATGAGCAAGTGTAA pLKO.1 3473 3UTR 100% 4.950 6.930 N SHPRH n/a
4 TRCN0000015556 GCACTTCTTATGGCGAGAGAT pLKO.1 1154 3UTR 100% 4.950 6.930 N SHPRH n/a
5 TRCN0000235918 GGTCTGAAACTCTACTATAAT pLKO_005 1188 3UTR 100% 15.000 12.000 N SHPRH n/a
6 TRCN0000015553 CCAGCGTTTGAGTGGGATTAA pLKO.1 2666 3UTR 100% 13.200 9.240 N SHPRH n/a
7 TRCN0000015555 CCAGGAGAAATCGCAGTAAAT pLKO.1 1867 3UTR 100% 13.200 9.240 N SHPRH n/a
8 TRCN0000235921 GAAATCCAGAATATCGAATTT pLKO_005 1434 3UTR 100% 13.200 9.240 N SHPRH n/a
9 TRCN0000084265 CGTGGCAAGATGTATTAGATA pLKO.1 4768 3UTR 100% 5.625 3.938 N Shprh n/a
10 TRCN0000298420 CGTGGCAAGATGTATTAGATA pLKO_005 4768 3UTR 100% 5.625 3.938 N Shprh n/a
11 TRCN0000235920 GATGATGATCCTTACTATTAT pLKO_005 1836 3UTR 100% 15.000 9.000 N SHPRH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_942393.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.