Transcript: Human XR_942606.2

PREDICTED: Homo sapiens serine active site containing 1 (SERAC1), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERAC1 (84947)
Length:
3898
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_942606.2
NBCI Gene record:
SERAC1 (84947)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_942606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415198 TTACTTCTGGGTATTGATTTG pLKO_005 2489 3UTR 100% 10.800 15.120 N SERAC1 n/a
2 TRCN0000430019 ACAATACCAGAGGAATAATTT pLKO_005 1647 3UTR 100% 15.000 10.500 N SERAC1 n/a
3 TRCN0000412377 AGTTTACTGGATCACTTATTT pLKO_005 236 3UTR 100% 15.000 10.500 N SERAC1 n/a
4 TRCN0000415061 GTCCTGCTCTCCGAATTATAT pLKO_005 1410 3UTR 100% 15.000 10.500 N SERAC1 n/a
5 TRCN0000420197 TAGGCATTGGAGATCTAATTC pLKO_005 1914 3UTR 100% 13.200 9.240 N SERAC1 n/a
6 TRCN0000150795 GCTTGGAATTTGTCCTAGATA pLKO.1 2706 3UTR 100% 5.625 3.938 N SERAC1 n/a
7 TRCN0000156152 CGAAGCGAAGAGAGTGATCTT pLKO.1 679 3UTR 100% 4.950 3.465 N SERAC1 n/a
8 TRCN0000155006 GCAAGGATTCTCCTGCACTTA pLKO.1 1761 3UTR 100% 4.950 3.465 N SERAC1 n/a
9 TRCN0000153225 GCTGGTCAAATGGTAAGTCTA pLKO.1 3765 3UTR 100% 4.950 3.465 N SERAC1 n/a
10 TRCN0000151193 GCTGTGACATTAGATACTCAA pLKO.1 304 3UTR 100% 4.950 3.465 N SERAC1 n/a
11 TRCN0000152395 GCATGATTACCAGTATAGGAT pLKO.1 615 3UTR 100% 3.000 2.100 N SERAC1 n/a
12 TRCN0000152226 CCTATGGAAAGAAAGTCCATT pLKO.1 1475 3UTR 100% 0.495 0.347 N SERAC1 n/a
13 TRCN0000177140 GAAGTCAAAGAACTCAGCAAA pLKO.1 1745 3UTR 100% 4.950 2.970 N Serac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_942606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09245 pDONR223 100% 48.3% None (many diffs) n/a
Download CSV