Transcript: Human XR_943492.3

PREDICTED: Homo sapiens tyrosyl-DNA phosphodiesterase 1 (TDP1), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDP1 (55775)
Length:
3956
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_943492.3
NBCI Gene record:
TDP1 (55775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_943492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048948 CCGATGAATCAAAGTGGTTAT pLKO.1 1721 3UTR 100% 10.800 15.120 N TDP1 n/a
2 TRCN0000291884 CCGATGAATCAAAGTGGTTAT pLKO_005 1721 3UTR 100% 10.800 15.120 N TDP1 n/a
3 TRCN0000048951 GCACGATCTCTCTGAAACAAA pLKO.1 1536 3UTR 100% 5.625 7.875 N TDP1 n/a
4 TRCN0000291883 GCACGATCTCTCTGAAACAAA pLKO_005 1536 3UTR 100% 5.625 7.875 N TDP1 n/a
5 TRCN0000369557 AGTTACTTGATGGCTTATAAT pLKO_005 1477 3UTR 100% 15.000 10.500 N TDP1 n/a
6 TRCN0000303366 CCACTTCCCTTAAAGTCTTAT pLKO_005 2408 3UTR 100% 13.200 9.240 N TDP1 n/a
7 TRCN0000048950 CCATATCTAGTAGTGATGAAA pLKO.1 326 3UTR 100% 5.625 3.938 N TDP1 n/a
8 TRCN0000048949 GCGGACCAGTTTAGAAGGATA pLKO.1 1845 3UTR 100% 4.950 3.465 N TDP1 n/a
9 TRCN0000307785 GCGGACCAGTTTAGAAGGATA pLKO_005 1845 3UTR 100% 4.950 3.465 N TDP1 n/a
10 TRCN0000048952 CCTTATGTCAAAGCACCGGAT pLKO.1 2281 3UTR 100% 2.160 1.512 N TDP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_943492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12271 pDONR223 100% 22.5% None 1_294del;1178_1224del;1236_3956del n/a
2 ccsbBroad304_12271 pLX_304 0% 22.5% V5 1_294del;1178_1224del;1236_3956del n/a
3 TRCN0000472852 TTCGCGTGACGCTTGCGGCCATAT pLX_317 42.5% 22.5% V5 1_294del;1178_1224del;1236_3956del n/a
Download CSV