Transcript: Human XR_944503.3

PREDICTED: Homo sapiens solute carrier family 5 member 8 (SLC5A8), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC5A8 (160728)
Length:
3066
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944503.3
NBCI Gene record:
SLC5A8 (160728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433192 TGCCTTGGTGCTAGCATATAA pLKO_005 2365 3UTR 100% 15.000 21.000 N SLC5A8 n/a
2 TRCN0000043579 CCTTATTTGGTACTGGACATT pLKO.1 1022 3UTR 100% 4.950 6.930 N SLC5A8 n/a
3 TRCN0000043581 GCCAACTCAATTGGAGCACTT pLKO.1 1361 3UTR 100% 4.050 5.670 N SLC5A8 n/a
4 TRCN0000428113 TTGATTGTCAAAGGTATATTC pLKO_005 2312 3UTR 100% 13.200 9.240 N SLC5A8 n/a
5 TRCN0000043578 CCACAGAAATGCCATTTACTA pLKO.1 1527 3UTR 100% 5.625 3.938 N SLC5A8 n/a
6 TRCN0000043580 GCAAGGTGGAATCAGCACTAT pLKO.1 682 3UTR 100% 4.950 3.465 N SLC5A8 n/a
7 TRCN0000043582 GTGTTCTACAAACTGGGAATT pLKO.1 368 3UTR 100% 0.000 0.000 N SLC5A8 n/a
8 TRCN0000434532 GGATTTGCATCCGTGATTATA pLKO_005 647 3UTR 100% 15.000 9.000 N SLC5A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09732 pDONR223 100% 59.6% None (many diffs) n/a
2 ccsbBroad304_09732 pLX_304 0% 59.6% V5 (many diffs) n/a
3 TRCN0000472672 AACCAGACCGTATATGCGCCGCGA pLX_317 19.9% 59.6% V5 (many diffs) n/a
Download CSV