Transcript: Human XR_946547.3

PREDICTED: Homo sapiens synaptotagmin 6 (SYT6), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYT6 (148281)
Length:
5893
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946547.3
NBCI Gene record:
SYT6 (148281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946547.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380602 GGAAACCCTCGGTTGTGATTT pLKO_005 3037 3UTR 100% 13.200 18.480 N SYT6 n/a
2 TRCN0000379736 GGCTCACCCTCACAGTGATTA pLKO_005 2672 3UTR 100% 13.200 18.480 N SYT6 n/a
3 TRCN0000236303 TAGTCTGGTAGTCCTACATTT pLKO_005 4908 3UTR 100% 13.200 18.480 N SYT6 n/a
4 TRCN0000155746 CGATGGACATCACAGGCTATT pLKO.1 2711 3UTR 100% 10.800 15.120 N SYT6 n/a
5 TRCN0000236302 TTCAGCCTACGCTACGATTAC pLKO_005 2245 3UTR 100% 10.800 15.120 N SYT6 n/a
6 TRCN0000154956 GCATCTCAGTGTCTTCGACTT pLKO.1 2478 3UTR 100% 4.050 5.670 N SYT6 n/a
7 TRCN0000154675 GATCAACTTCAGCCTACGCTA pLKO.1 2238 3UTR 100% 2.640 3.696 N SYT6 n/a
8 TRCN0000236304 ATCTGGAAGGATATCCAATAT pLKO_005 2584 3UTR 100% 13.200 10.560 N SYT6 n/a
9 TRCN0000380627 ATGAGATGTGCAGCCAAATAA pLKO_005 3174 3UTR 100% 15.000 10.500 N SYT6 n/a
10 TRCN0000380878 GCACTTGTTCAACCGTCTAAA pLKO_005 3224 3UTR 100% 13.200 9.240 N SYT6 n/a
11 TRCN0000236305 ATCTCAGTGTCTTCGACTTTG pLKO_005 2480 3UTR 100% 10.800 7.560 N SYT6 n/a
12 TRCN0000380753 ATGTCTCCAGTGTAGACTATG pLKO_005 2093 3UTR 100% 10.800 7.560 N SYT6 n/a
13 TRCN0000381748 GATGGACATCACAGGCTATTC pLKO_005 2712 3UTR 100% 10.800 7.560 N SYT6 n/a
14 TRCN0000154596 GCATGTCTCCAGTGTAGACTA pLKO.1 2091 3UTR 100% 4.950 3.465 N SYT6 n/a
15 TRCN0000156189 CACAAGTGAAAGCGTGGACTT pLKO.1 2607 3UTR 100% 4.050 2.835 N SYT6 n/a
16 TRCN0000154940 GCTCATCTCAGTCATGGACTA pLKO.1 2880 3UTR 100% 4.050 2.835 N SYT6 n/a
17 TRCN0000154644 CCGTCTAAACAGTGTTGTGCA pLKO.1 3236 3UTR 100% 2.640 1.848 N SYT6 n/a
18 TRCN0000380698 CTCTCAATCCTGTCTACAATG pLKO_005 2810 3UTR 100% 10.800 6.480 N SYT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946547.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05010 pDONR223 100% 21.2% None 1_1797del;3033_3034ins21;3052_5893del n/a
2 ccsbBroad304_05010 pLX_304 0% 21.2% V5 1_1797del;3033_3034ins21;3052_5893del n/a
3 TRCN0000471407 GGGTGCAAATAAAATGAGCCCCAC pLX_317 29.2% 21.2% V5 1_1797del;3033_3034ins21;3052_5893del n/a
Download CSV