Transcript: Human XR_946568.3

PREDICTED: Homo sapiens ALG14 UDP-N-acetylglucosaminyltransferase subunit (ALG14), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALG14 (199857)
Length:
1114
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946568.3
NBCI Gene record:
ALG14 (199857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146599 CAAATGGCAACTGACTTCTTT pLKO.1 842 3UTR 100% 5.625 7.875 N ALG14 n/a
2 TRCN0000147745 CTGACAGTCCTGAGAATTATT pLKO.1 937 3UTR 100% 15.000 10.500 N ALG14 n/a
3 TRCN0000435682 ACCCTACATGTTTCTTGTAAA pLKO_005 911 3UTR 100% 13.200 9.240 N ALG14 n/a
4 TRCN0000429346 GATCATTGTCTACGTTGAAAG pLKO_005 691 3UTR 100% 10.800 7.560 N ALG14 n/a
5 TRCN0000150263 GAGGCTTCTCTTATGAAACAA pLKO.1 1003 3UTR 100% 5.625 3.938 N ALG14 n/a
6 TRCN0000179241 GAAGAAACTGAGGCTTCTCTT pLKO.1 994 3UTR 100% 4.950 2.970 N ALG14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09800 pDONR223 100% 58% None (many diffs) n/a
2 ccsbBroad304_09800 pLX_304 0% 58% V5 (many diffs) n/a
3 TRCN0000474727 CGTGGCCTGTGACTCCAGGGAATA pLX_317 70.3% 58% V5 (many diffs) n/a
Download CSV