Transcript: Human XR_946576.2

PREDICTED: Homo sapiens EPH receptor A8 (EPHA8), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EPHA8 (2046)
Length:
2270
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946576.2
NBCI Gene record:
EPHA8 (2046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001348 CTATAAGAAGTGCCCTGCCAT pLKO.1 714 3UTR 100% 2.640 3.696 N EPHA8 n/a
2 TRCN0000001347 GCGAAGTGAATTTGCTGGACA pLKO.1 203 3UTR 100% 2.640 3.696 N EPHA8 n/a
3 TRCN0000195445 CAGTGTGAATGGGACATCAGT pLKO.1 1125 3UTR 100% 3.000 2.400 N EPHA8 n/a
4 TRCN0000218057 TCTATGCTGAGATCAAGTTTA pLKO_005 404 3UTR 100% 13.200 9.240 N EPHA8 n/a
5 TRCN0000230030 TCTCTCTCCGCATCTACTATA pLKO_005 698 3UTR 100% 13.200 9.240 N EPHA8 n/a
6 TRCN0000230031 GCAGTGACATCACCTACAATG pLKO_005 1184 3UTR 100% 10.800 7.560 N EPHA8 n/a
7 TRCN0000195591 CGCAGTGACATCACCTACAAT pLKO.1 1183 3UTR 100% 5.625 3.938 N EPHA8 n/a
8 TRCN0000356087 ACCAGGTTTGCAACGTCATGA pLKO_005 323 3UTR 100% 4.950 3.465 N EPHA8 n/a
9 TRCN0000001346 GACGAGGAGAAGATGCACTAT pLKO.1 2116 3UTR 100% 4.950 3.465 N EPHA8 n/a
10 TRCN0000196492 GAGTATGAGATCAAGTACTAC pLKO.1 1528 3UTR 100% 4.950 3.465 N EPHA8 n/a
11 TRCN0000230032 GAGTATGAGATCAAGTACTAC pLKO_005 1528 3UTR 100% 4.950 3.465 N EPHA8 n/a
12 TRCN0000356065 GGAGAAGATGCACTATCAGAA pLKO_005 2121 3UTR 100% 4.950 3.465 N EPHA8 n/a
13 TRCN0000377266 TTCTGGATCGAGGCCGTCAAT pLKO_005 1342 3UTR 100% 4.950 3.465 N EPHA8 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1738 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1738 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06170 pDONR223 100% 62.7% None (many diffs) n/a
2 ccsbBroad304_06170 pLX_304 0% 62.7% V5 (many diffs) n/a
3 TRCN0000470862 CCTTATTTCTCCCTATTGCCCGTC pLX_317 27.7% 62.7% V5 (many diffs) n/a
Download CSV