Transcript: Human XR_946674.2

PREDICTED: Homo sapiens suppression of tumorigenicity 7 like (ST7L), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST7L (54879)
Length:
6199
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946674.2
NBCI Gene record:
ST7L (54879)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038100 CCTTTCATCATGTTTCTGTTT pLKO.1 1260 3UTR 100% 4.950 3.465 N ST7L n/a
2 TRCN0000038099 GCAGACAGAATTTGTCAGAAT pLKO.1 448 3UTR 100% 4.950 3.465 N ST7L n/a
3 TRCN0000038101 CCCAAATTCTATGTGGCACTT pLKO.1 246 3UTR 100% 4.050 2.835 N ST7L n/a
4 TRCN0000038102 GCTCGAATCAAAGCAGCCTAT pLKO.1 672 3UTR 100% 4.050 2.835 N ST7L n/a
5 TRCN0000042471 GCTGTGGAATTTAATCCTCAT pLKO.1 1230 3UTR 100% 4.050 2.430 N St7l n/a
6 TRCN0000327276 GCTGTGGAATTTAATCCTCAT pLKO_005 1230 3UTR 100% 4.050 2.430 N St7l n/a
7 TRCN0000038103 CCTCAGGCTTTGAGGAGAATA pLKO.1 1434 3UTR 100% 1.320 0.792 N ST7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03473 pDONR223 100% 22.9% None 1_14del;1258_1259ins244;1496_6199del n/a
2 ccsbBroad304_03473 pLX_304 0% 22.9% V5 1_14del;1258_1259ins244;1496_6199del n/a
3 TRCN0000468738 TATGCGGGTTCGGTCTTAGAATAA pLX_317 23.8% 22.9% V5 1_14del;1258_1259ins244;1496_6199del n/a
Download CSV