Transcript: Human XR_947795.2

PREDICTED: Homo sapiens CWF19 like cell cycle control factor 2 (CWF19L2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CWF19L2 (143884)
Length:
3338
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_947795.2
NBCI Gene record:
CWF19L2 (143884)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_947795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417172 GCCGAAAGATATGGGTCAATG pLKO_005 789 3UTR 100% 10.800 15.120 N CWF19L2 n/a
2 TRCN0000422940 TGCAATAGGTGTTAAGGTTTA pLKO_005 2093 3UTR 100% 10.800 15.120 N CWF19L2 n/a
3 TRCN0000134258 CGGGATACAAAGTCTACATTT pLKO.1 1431 3UTR 100% 13.200 9.240 N CWF19L2 n/a
4 TRCN0000419032 GATGATAATCTAAGCCTAAAT pLKO_005 1803 3UTR 100% 13.200 9.240 N CWF19L2 n/a
5 TRCN0000134751 GCATCCACGAAAGAAGATTAT pLKO.1 849 3UTR 100% 13.200 9.240 N CWF19L2 n/a
6 TRCN0000421355 GGTAGAAGATGGTGGATTAAG pLKO_005 695 3UTR 100% 13.200 9.240 N CWF19L2 n/a
7 TRCN0000134054 CCATTGCATCTAATGAAGCAA pLKO.1 2837 3UTR 100% 3.000 2.100 N CWF19L2 n/a
8 TRCN0000135387 GAACAGTCCAAACTGATGGAA pLKO.1 588 3UTR 100% 3.000 2.100 N CWF19L2 n/a
9 TRCN0000135495 GTGGTGGAAACCATATGACTT pLKO.1 2743 3UTR 100% 0.000 0.000 N CWF19L2 n/a
10 TRCN0000134074 GAGTGTTGATGAGAAGAACAA pLKO.1 1487 3UTR 100% 4.950 2.970 N CWF19L2 n/a
11 TRCN0000136003 GCAGCTACTTTGTTGGATGAA pLKO.1 2184 3UTR 100% 4.950 2.970 N CWF19L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_947795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.