Transcript: Human XR_948291.2

PREDICTED: Homo sapiens solute carrier family 22 member 5 (SLC22A5), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A5 (6584)
Length:
3370
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_948291.2
NBCI Gene record:
SLC22A5 (6584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_948291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425143 GAAAGGCCCACAATCCTTAAA pLKO_005 1993 3UTR 100% 13.200 18.480 N SLC22A5 n/a
2 TRCN0000295729 GACCATATCAGTGGGCTATTT pLKO_005 1410 3UTR 100% 13.200 18.480 N Slc22a5 n/a
3 TRCN0000038181 GCAGATCTTCTCGAAGAATTT pLKO.1 899 3UTR 100% 13.200 18.480 N SLC22A5 n/a
4 TRCN0000038179 CGAGTGAGTTACAAGACCTAA pLKO.1 1298 3UTR 100% 4.950 6.930 N SLC22A5 n/a
5 TRCN0000038183 CCAATGGGATTGTTGTGCCTT pLKO.1 1262 3UTR 100% 2.640 3.696 N SLC22A5 n/a
6 TRCN0000424856 ACGTTAGGAGTGTGCATATTT pLKO_005 1048 3UTR 100% 15.000 10.500 N SLC22A5 n/a
7 TRCN0000423919 TGGCTGCTGCTGCAATATTTG pLKO_005 1525 3UTR 100% 13.200 9.240 N SLC22A5 n/a
8 TRCN0000414368 CCAACTATGTGGCAGCATTTG pLKO_005 967 3UTR 100% 10.800 7.560 N SLC22A5 n/a
9 TRCN0000038180 CCCACTCACAATCTCCTTGTT pLKO.1 767 3UTR 100% 4.950 3.465 N SLC22A5 n/a
10 TRCN0000038182 GACCAGATGCTAAGAGTCAAA pLKO.1 1918 3UTR 100% 4.950 3.465 N SLC22A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_948291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06974 pDONR223 100% 49.5% None (many diffs) n/a
2 ccsbBroad304_06974 pLX_304 0% 49.5% V5 (many diffs) n/a
3 TRCN0000476123 ATTCCGCTAATGAGCCTCCCGTCA pLX_317 21.9% 49.5% V5 (many diffs) n/a
Download CSV