Transcript: Mouse NM_001197046.1

Mus musculus Fgfr1 oncogene partner (Fgfr1op), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fgfr1op (75296)
Length:
3171
CDS:
80..1279

Additional Resources:

NCBI RefSeq record:
NM_001197046.1
NBCI Gene record:
Fgfr1op (75296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001197046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251869 GTTAGACCATTACGGTTATAT pLKO_005 1769 3UTR 100% 15.000 21.000 N Fgfr1op n/a
2 TRCN0000184343 GACGGGAACACCAGTGATAAA pLKO.1 1184 CDS 100% 13.200 18.480 N Fgfr1op n/a
3 TRCN0000251865 GACGGGAACACCAGTGATAAA pLKO_005 1184 CDS 100% 13.200 18.480 N Fgfr1op n/a
4 TRCN0000251867 GCTAGTCTCGTCGCAGAATTT pLKO_005 302 CDS 100% 13.200 18.480 N Fgfr1op n/a
5 TRCN0000183354 GCGTCTGTAATGTTAAAGTAT pLKO.1 2222 3UTR 100% 5.625 7.875 N Fgfr1op n/a
6 TRCN0000084092 CAAGTAAGATACCAAGGTATA pLKO.1 591 CDS 100% 10.800 7.560 N FGFR1OP n/a
7 TRCN0000251866 GAGACAAGAATTGCATCTTTC pLKO_005 746 CDS 100% 10.800 7.560 N Fgfr1op n/a
8 TRCN0000179295 GTGGAAGGAGATTCTTTCTTT pLKO.1 827 CDS 100% 5.625 3.938 N Fgfr1op n/a
9 TRCN0000084091 CCAAGTAAGATACCAAGGTAT pLKO.1 590 CDS 100% 4.950 3.465 N FGFR1OP n/a
10 TRCN0000251868 CTGTGGGTGGACCCTTATTAT pLKO_005 444 CDS 100% 15.000 9.000 N Fgfr1op n/a
11 TRCN0000294394 CTGTGGGTGGACCCTTATTAT pLKO_005 444 CDS 100% 15.000 9.000 N FGFR1OP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001197046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07754 pDONR223 100% 82% 79.9% None (many diffs) n/a
2 ccsbBroad304_07754 pLX_304 0% 82% 79.9% V5 (many diffs) n/a
3 TRCN0000468162 CGAAATTGTCCAGAAATAATCTCC pLX_317 34.7% 82% 79.9% V5 (many diffs) n/a
Download CSV