Transcript: Human XM_011523239.1

PREDICTED: Homo sapiens translin associated factor X interacting protein 1 (TSNAXIP1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSNAXIP1 (55815)
Length:
2061
CDS:
43..1986

Additional Resources:

NCBI RefSeq record:
XM_011523239.1
NBCI Gene record:
TSNAXIP1 (55815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162106 CAACGAGGTTATGAGTCAGTT pLKO.1 1359 CDS 100% 4.950 6.930 N TSNAXIP1 n/a
2 TRCN0000136678 GAGCTTGGCATAGAACTCCAT pLKO.1 1729 CDS 100% 2.640 2.112 N TSNAXIP1 n/a
3 TRCN0000160785 CGAGTACTTACAGCAGCTAAA pLKO.1 1704 CDS 100% 10.800 7.560 N TSNAXIP1 n/a
4 TRCN0000162387 CAATGCAGACTTGCTCAACTA pLKO.1 1599 CDS 100% 4.950 3.465 N TSNAXIP1 n/a
5 TRCN0000162704 CTCTCAAGACAGAAGAGCAAA pLKO.1 1535 CDS 100% 4.950 3.465 N TSNAXIP1 n/a
6 TRCN0000161588 GAGTCAGTTCTATGCAGTCTT pLKO.1 1371 CDS 100% 4.950 3.465 N TSNAXIP1 n/a
7 TRCN0000162975 GCTGCTGAAGGAGATGACAAA pLKO.1 1446 CDS 100% 4.950 3.465 N TSNAXIP1 n/a
8 TRCN0000134949 GTTCCCAGATTTCTTCTTCAA pLKO.1 1257 CDS 100% 4.950 3.465 N TSNAXIP1 n/a
9 TRCN0000161175 GAATGTGTATGTCACCCAGAA pLKO.1 1410 CDS 100% 4.050 2.835 N TSNAXIP1 n/a
10 TRCN0000137054 CCAACGAGGTTATGAGTCAGT pLKO.1 1358 CDS 100% 2.640 1.848 N TSNAXIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03660 pDONR223 100% 75.4% 75.4% None (many diffs) n/a
2 ccsbBroad304_03660 pLX_304 0% 75.4% 75.4% V5 (many diffs) n/a
3 TRCN0000479326 TAGCTATCACCGTTGACATGTTTC pLX_317 22.9% 75.4% 75.4% V5 (many diffs) n/a
Download CSV