Construct: ORF TRCN0000479326
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010050.1_s317c1
- Derived from:
- ccsbBroadEn_03660
- DNA Barcode:
- TAGCTATCACCGTTGACATGTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TSNAXIP1 (55815)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479326
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55815 | TSNAXIP1 | translin associated factor ... | NM_018430.4 | 100% | 100% | |
| 2 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523235.1 | 95.3% | 95.3% | 820_840del;1002_1076del |
| 3 | human | 55815 | TSNAXIP1 | translin associated factor ... | NM_001288990.3 | 92.4% | 92.4% | 1_162del |
| 4 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523233.2 | 91.5% | 91.5% | 1_162del;982_1002del |
| 5 | human | 55815 | TSNAXIP1 | translin associated factor ... | NM_001288991.3 | 90.5% | 83.6% | (many diffs) |
| 6 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523232.2 | 90.3% | 90.3% | 1_162del;982_1002del;1164_1190del |
| 7 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023448.1 | 89.9% | 86.8% | (many diffs) |
| 8 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523231.2 | 89.2% | 89.2% | 1_162del;1143_1217del |
| 9 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023446.1 | 88.7% | 85.6% | (many diffs) |
| 10 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523230.2 | 88.4% | 88.4% | 1_162del;982_1002del;1164_1238del |
| 11 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523237.2 | 88% | 85% | (many diffs) |
| 12 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023445.2 | 87.3% | 80.6% | (many diffs) |
| 13 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_005256049.4 | 87.2% | 87.2% | 1_162del;980_981ins111 |
| 14 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_024450350.1 | 86.7% | 83.6% | (many diffs) |
| 15 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523236.3 | 86.5% | 79.8% | (many diffs) |
| 16 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523238.1 | 85.8% | 82.8% | (many diffs) |
| 17 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023449.2 | 85.1% | 78.1% | (many diffs) |
| 18 | human | 55815 | TSNAXIP1 | translin associated factor ... | NM_001351158.2 | 84.4% | 81.2% | (many diffs) |
| 19 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523234.2 | 84.2% | 84.2% | 1_162del;980_981ins111;1032_1106del |
| 20 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023450.1 | 84.1% | 84.1% | 0_1ins312 |
| 21 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023451.1 | 84.1% | 84.1% | 0_1ins312 |
| 22 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023447.2 | 82.1% | 75.4% | (many diffs) |
| 23 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523240.1 | 80.2% | 80.2% | 0_1ins312;508_528del;690_764del |
| 24 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023453.1 | 79.3% | 79.3% | 0_1ins408 |
| 25 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023454.1 | 79.3% | 79.3% | 0_1ins408 |
| 26 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_024450351.1 | 78.7% | 78.7% | 1_162del;385_386ins291 |
| 27 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023452.1 | 76.4% | 76.4% | 0_1ins408;573_647del |
| 28 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523241.1 | 75.6% | 75.6% | 0_1ins408;412_432del;594_668del |
| 29 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523242.1 | 75.6% | 75.6% | 0_1ins408;412_432del;594_668del |
| 30 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523239.1 | 75.4% | 75.4% | (many diffs) |
| 31 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_017023455.1 | 73.7% | 73.7% | 0_1ins408;410_411ins111 |
| 32 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_011523243.1 | 64.9% | 64.9% | 0_1ins630;190_210del;372_446del |
| 33 | human | 55815 | TSNAXIP1 | translin associated factor ... | NM_001288992.3 | 55.6% | 55.6% | 0_1ins876 |
| 34 | human | 55815 | TSNAXIP1 | translin associated factor ... | NM_001288993.3 | 55.6% | 55.6% | 0_1ins876 |
| 35 | human | 55815 | TSNAXIP1 | translin associated factor ... | NM_001288994.3 | 55.6% | 55.6% | 0_1ins876 |
| 36 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_024450352.1 | 53.5% | 53.5% | 0_1ins876;105_179del |
| 37 | human | 55815 | TSNAXIP1 | translin associated factor ... | XM_024450353.1 | 53.5% | 53.5% | 0_1ins876;105_179del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2043
- ORF length:
- 1974
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggtgggcac ctgtccccat ggcccacata caccagtggc cagaccattt 121 tgcaaaatcg aaaaccctgt tcagatgact accggaagcg agtagggagc tgccagcagc 181 acccctttcg cactgccaag ccccagtact tggaggaact ggaaaactac ctacgcaagg 241 agctcctcct gctggacctg ggcacagatt ccacccagga actaaggctg cagccttaca 301 gagagatctt tgagttcttc atagaggact tcaaaacgta caagccatta ctatcctcca 361 tcaagaatgc gtatgagggg atgctggccc accaaaggga gaagattcgg gctctggagc 421 ccctgaaggc caagcttgtc actgtgaatg aggactgcaa tgagaggatc ctggccatga 481 gagctgagga gaaatatgaa atctccctgc tcaagaaaga gaagatgaac ttgctaaaac 541 tcatcgacaa aaagaatgag gagaagattt cattgcagag cgaggtgacc aaactgagga 601 agaacttggc tgaggagtac ctgcactacc tcagtgagcg agatgcctgt aagatcctca 661 tcgcagacct gaatgagctg cggtaccagc gggaggacat gtcattagcc cagtcgccag 721 gcatctgggg ggaggaccct gtgaagttaa ccctggctct taagatgacc cggcaagacc 781 tgacccgcac gcagatggaa ctcaacaaca tgaaggccaa ctttggagat gtggtcccca 841 ggagggactt tgaaatgcag gagaagacca acaaggatct tcaggagcag ctggacaccc 901 tgagagccag ctacgaggag gttcgcaagg agcatgagat cctcatgcag ctgcacatga 961 gcacgctgaa ggaacgggac caattcttct ctgagctgca ggagatccag cgcacttcca 1021 cgccgcggcc tgactggacc aagtgcaaag atgtggtggc tgggggccca gagcgctggc 1081 agatgctggc tgagggcaag aacagcgacc agctggtgga cgtgctcctg gaagagattg 1141 gttcggggct gctgcgggag aaagacttct tccctggtct gggctatggg gaagccatcc 1201 ctgcttttct tcggtttgat ggcctcgtgg agaacaagaa gccaagcaag aaggacgtgg 1261 tcaacctcct caaggatgcc tggaaggaac gtcttgctga ggagcagaaa gagacgttcc 1321 cagatttctt cttcaatttc ctggagcatc gctttgggcc cagtgatgcc atggcctggg 1381 cttatactat ttttgaaaat atcaagatct tccactccaa cgaggttatg agtcagttct 1441 atgcagtctt gatgggaaag cggagtgaga atgtgtatgt cacccagaag gagacagtag 1501 cccagctgct gaaggagatg acaaatgctg acagtcagaa cgaggggcta ctaaccatgg 1561 agcagttcaa cactgtcctc aagagtacct tcccTCTCAA GACAGAAGAG CAAATCCAGG 1621 AGCTGATGGA GGCAGGGGGC TGGCATCCCA GCAGCAGCAA TGCAGACTTG CTCAACTACC 1681 GCTCACTGTT TATGGAGGAT GAGGAGGGCC AGAGTGAGCC CTTTGTGCAA AAACTCTGGG 1741 AACAATACAT GGATGAGAAG GACGAGTACT TACAGCAGCT AAAGCAGGAG CTTGGCATAG 1801 AACTCCATGA GGAAGTGACT CTGCCCAAGC TGCGAGGGGG CCTGATGACC ATCGACCCCA 1861 GCCTGGACAA GCAGACAGTG AACACCTACA TGAGCCAGGC CTTCCAGCTC CCTGAGTCGG 1921 AAATGCCAGA GGAGGGTGAC GAGAAGGAAG AAGCCGTGGT GGAAATCCTC CAGACTGCCC 1981 TGGAGCGGCT TCAGGTGATT GACATCAGGC GTGTGGGACC TCGAGAGCCA GAGCCTGCAA 2041 GCTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 2101 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 2161 GGCTTTATAT ATCTTGTGGA AAGGACGATA GCTATCACCG TTGACATGTT TCACGCGTTA 2221 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt