Construct: ORF TRCN0000465263
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006627.1_s317c1
- Derived from:
- ccsbBroadEn_11888
- DNA Barcode:
- AGGAATGTTACTACTGCAGGTCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SNX24 (28966)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465263
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 28966 | SNX24 | sorting nexin 24 | NM_014035.4 | 90% | 87.5% | (many diffs) |
| 2 | human | 28966 | SNX24 | sorting nexin 24 | XM_006714592.4 | 88.7% | 87.2% | (many diffs) |
| 3 | human | 28966 | SNX24 | sorting nexin 24 | XM_011543350.3 | 74.6% | 73.3% | (many diffs) |
| 4 | human | 28966 | SNX24 | sorting nexin 24 | XM_017009394.1 | 74.2% | 71.5% | (many diffs) |
| 5 | human | 28966 | SNX24 | sorting nexin 24 | XM_005271972.5 | 71.6% | 69.4% | (many diffs) |
| 6 | human | 28966 | SNX24 | sorting nexin 24 | XM_011543349.3 | 62% | 60.1% | (many diffs) |
| 7 | human | 28966 | SNX24 | sorting nexin 24 | XM_011543352.1 | 47.7% | 44.2% | (many diffs) |
| 8 | human | 28966 | SNX24 | sorting nexin 24 | XM_017009396.1 | 47.7% | 44.2% | (many diffs) |
| 9 | human | 28966 | SNX24 | sorting nexin 24 | XM_017009395.1 | 46.1% | 44.1% | (many diffs) |
| 10 | human | 28966 | SNX24 | sorting nexin 24 | XR_001742058.1 | 43.2% | (many diffs) | |
| 11 | human | 28966 | SNX24 | sorting nexin 24 | NR_146145.1 | 19.9% | (many diffs) | |
| 12 | mouse | 69226 | Snx24 | sorting nexing 24 | NM_029394.3 | 82.3% | 85.7% | (many diffs) |
| 13 | mouse | 69226 | Snx24 | sorting nexing 24 | XM_006526220.3 | 56.4% | 58.7% | (many diffs) |
| 14 | mouse | 69226 | Snx24 | sorting nexing 24 | XM_006526221.3 | 47.4% | 48.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 543
- ORF length:
- 477
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggtctacatc ccgtcctttc gctatgaaga gagcgacctg gagcggggat 121 acacggtgtt taagatagaa gtgctaatga atggaagaaa acattttgtt gaaaagagat 181 acagcgaatt tcatgctttg cacaaaaagc ttaagaaatg tataaaaact ccagaaatcc 241 cttctaaaca tgttaggaac tgggtcccca aagtcttgga acagcgacga caaggcttgG 301 AAACATACTT ACAGGCTGTC ATTTTAGAAA ATGAAGAACT TCCCAAACTG TTTCTTGATT 361 TCCTAAATGT GCGACACTTG CCCTCTCTAC CAAAGGCAGA AAGTTGTGGA TCTTTTGATG 421 AAACAGAGTC TGAAGAGTCA AGCAAACTGT CCCACCAGCC TGTGCTGCTG TTCCTCAGGG 481 ATCCATATGT CTTGCCTGCA GCCAGCGGTA ATCAAACCTG TCATCTGCTA ACAGCTCTTT 541 ACTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 601 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 661 GGCTTTATAT ATCTTGTGGA AAGGACGAAG GAATGTTACT ACTGCAGGTC GCACGCGTTA 721 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt