Transcript: Human XM_005271972.5

PREDICTED: Homo sapiens sorting nexin 24 (SNX24), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX24 (28966)
Length:
3877
CDS:
59..700

Additional Resources:

NCBI RefSeq record:
XM_005271972.5
NBCI Gene record:
SNX24 (28966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271972.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380214 GGAGTCCTCCATGGGATATTT pLKO_005 524 CDS 100% 15.000 21.000 N SNX24 n/a
2 TRCN0000133890 CCAGAAATCCCTTCTAAACAT pLKO.1 224 CDS 100% 5.625 3.938 N SNX24 n/a
3 TRCN0000134320 GAAGTGCTAATGAATGGAAGA pLKO.1 131 CDS 100% 4.050 2.835 N SNX24 n/a
4 TRCN0000135685 CAAAGGCAGAAAGTTGTGGAT pLKO.1 384 CDS 100% 2.640 1.848 N SNX24 n/a
5 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3854 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271972.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03046 pDONR223 100% 79.3% 79.3% None 508_639del n/a
2 ccsbBroad304_03046 pLX_304 0% 79.3% 79.3% V5 508_639del n/a
3 TRCN0000491504 GTATCCACATATGTTTTGTTCTCC pLX_317 54% 79.3% 79.3% V5 508_639del n/a
4 ccsbBroadEn_11888 pDONR223 100% 71.6% 69.4% None (many diffs) n/a
5 ccsbBroad304_11888 pLX_304 0% 71.6% 69.4% V5 (many diffs) n/a
6 TRCN0000465263 AGGAATGTTACTACTGCAGGTCGC pLX_317 51.1% 71.6% 69.4% V5 (many diffs) n/a
Download CSV