Transcript: Mouse XM_006526221.3

PREDICTED: Mus musculus sorting nexing 24 (Snx24), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx24 (69226)
Length:
3509
CDS:
1628..2245

Additional Resources:

NCBI RefSeq record:
XM_006526221.3
NBCI Gene record:
Snx24 (69226)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362632 CAAGGCCTGGAAACGTATTTA pLKO_005 2087 CDS 100% 15.000 21.000 N Snx24 n/a
2 TRCN0000362631 CGCGGCTACACGGTGTTTAAA pLKO_005 1910 CDS 100% 15.000 21.000 N Snx24 n/a
3 TRCN0000362563 ACTTGCCCTCTCTACCGAAAG pLKO_005 2172 CDS 100% 6.000 8.400 N Snx24 n/a
4 TRCN0000192321 CGTATTTACAGGCCGTCATTT pLKO.1 2100 CDS 100% 13.200 9.240 N Snx24 n/a
5 TRCN0000202128 CCTCTCTACCGAAAGCAGAAA pLKO.1 2178 CDS 100% 4.950 2.970 N Snx24 n/a
6 TRCN0000133890 CCAGAAATCCCTTCTAAACAT pLKO.1 2027 CDS 100% 5.625 4.500 N SNX24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11888 pDONR223 100% 47.4% 48.9% None (many diffs) n/a
2 ccsbBroad304_11888 pLX_304 0% 47.4% 48.9% V5 (many diffs) n/a
3 TRCN0000465263 AGGAATGTTACTACTGCAGGTCGC pLX_317 51.1% 47.4% 48.9% V5 (many diffs) n/a
4 ccsbBroadEn_03046 pDONR223 100% 45.4% 46.9% None (many diffs) n/a
5 ccsbBroad304_03046 pLX_304 0% 45.4% 46.9% V5 (many diffs) n/a
6 TRCN0000491504 GTATCCACATATGTTTTGTTCTCC pLX_317 54% 45.4% 46.9% V5 (many diffs) n/a
Download CSV