Transcript: Human NM_001316345.2

Homo sapiens reversion inducing cysteine rich protein with kazal motifs (RECK), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RECK (8434)
Length:
4548
CDS:
607..3138

Additional Resources:

NCBI RefSeq record:
NM_001316345.2
NBCI Gene record:
RECK (8434)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001316345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073524 CGCCTCTATTAGTCCACAATT pLKO.1 783 CDS 100% 13.200 18.480 N RECK n/a
2 TRCN0000369962 CCGCCAATATTAGTAGGATTT pLKO_005 3283 3UTR 100% 10.800 15.120 N RECK n/a
3 TRCN0000377366 GCGTGGCAGTCGATTACTATG pLKO_005 2555 CDS 100% 10.800 15.120 N RECK n/a
4 TRCN0000073525 GCGCCTCTATTAGTCCACAAT pLKO.1 782 CDS 100% 4.950 6.930 N RECK n/a
5 TRCN0000365008 CCTTACTTACTGTACTAATTT pLKO_005 1278 CDS 100% 15.000 12.000 N RECK n/a
6 TRCN0000375144 GACCTCCAGAAGTCTTGTATT pLKO_005 1948 CDS 100% 13.200 10.560 N Reck n/a
7 TRCN0000073526 GCATTGTTGTTCTAAAGCAAA pLKO.1 1092 CDS 100% 4.950 3.960 N RECK n/a
8 TRCN0000364972 AGGAACCCAACGGATAGTTTA pLKO_005 844 CDS 100% 13.200 9.240 N RECK n/a
9 TRCN0000369961 TGTGAACAATTATACTCAATC pLKO_005 813 CDS 100% 10.800 7.560 N RECK n/a
10 TRCN0000073523 GCTGATTAAATGACACTCATA pLKO.1 3742 3UTR 100% 4.950 3.465 N RECK n/a
11 TRCN0000073527 GCAGATCAGTTTGTCCCTGTA pLKO.1 2128 CDS 100% 4.050 2.835 N RECK n/a
12 TRCN0000376461 TACCTCAGGCCAAGTACTTTA pLKO_005 1651 CDS 100% 0.000 0.000 N RECK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11272 pDONR223 100% 9.4% 8% None (many diffs) n/a
2 ccsbBroad304_11272 pLX_304 0% 9.4% 8% V5 (many diffs) n/a
3 TRCN0000465287 CCCACCGCCAACCTTGGGCGTTCT pLX_317 50.9% 9.4% 8% V5 (many diffs) n/a
Download CSV