Construct: ORF TRCN0000465348
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011996.1_s317c1
- Derived from:
- ccsbBroadEn_15683
- DNA Barcode:
- TAGGGTCCGCGCCGTGCGTGGTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMCC2 (9911)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465348
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9911 | TMCC2 | transmembrane and coiled-co... | NM_001297613.1 | 59.4% | 43.4% | (many diffs) |
| 2 | human | 9911 | TMCC2 | transmembrane and coiled-co... | NM_001297611.1 | 57.6% | 42.1% | (many diffs) |
| 3 | human | 9911 | TMCC2 | transmembrane and coiled-co... | NM_001331034.1 | 54.3% | 39.8% | (many diffs) |
| 4 | human | 9911 | TMCC2 | transmembrane and coiled-co... | NM_001242925.1 | 44.3% | 32.7% | (many diffs) |
| 5 | human | 9911 | TMCC2 | transmembrane and coiled-co... | XM_005245684.2 | 44.3% | 32.7% | (many diffs) |
| 6 | human | 9911 | TMCC2 | transmembrane and coiled-co... | XM_005245685.4 | 44.3% | 32.7% | (many diffs) |
| 7 | human | 9911 | TMCC2 | transmembrane and coiled-co... | XM_005245686.3 | 39.9% | 32.3% | (many diffs) |
| 8 | human | 9911 | TMCC2 | transmembrane and coiled-co... | NM_014858.4 | 39.5% | 29.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1002
- ORF length:
- 936
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggagaaggtg gcctaccagt cctatgagag ggcacgggac atccaggagg 121 ccgtggagtc ctgcctgacc cgggtcacca agctggagct gcagcagcaa cagcagcagg 181 tggtacagct ggagggcgtg gagaatgcca acgcgcgggc gctgctgggc aagttcatca 241 acgtgcgcgc aggcatcagc ggctttgggg gcggcgtggt ggagggcgtc aagggcagcc 301 tctctggcct ctcacaggcc acccacaccg ccgtggtgtc caagccccgg gagtttgcca 361 gcctcatccg caacaagttt ggcagtgctg acaacatcgc ccacctgaag gaccccctgg 421 aagatgggcc ccctgaggag gcagcccggg cactgagcgg cagtgccaca ctcgtctcca 481 gccccaagta tggcagcgat gatgagtgct ccagcgccag cgccagctca gccggggcag 541 gcagcaactc tggggctggg cctggtgggg cgctggggag ccctaagtcc aatgcactgt 601 atggtgctcc tggaaacctg gatgctctgc tggaagagct acgggagatc aaggagggac 661 agtctcacct ggaggactcc atggaagacc tgaagacTCA GCTGCAGAGG GACTACACCT 721 ACATGACCCA GTGCCTGCAG GAGGAGCGCT ACAGGTACGA GCGGCTGGAG GAGCAGCTCA 781 ACGACCTGAC TGAGCTTCAT CAGAACGAGA TGACGAACCT GAAGCAGGAG CTGGCCACAC 841 TTCTCCAGGA GGGACCCTTG GACTTCTTTG TGTGTCCAGT TTGGCCTCCT GCCCAAACTG 901 TCCATTCCAG CAGCTCCTGC CCCCTTCTCT GTACTTGCTT CTGTCTGACA CCTTCTCCCT 961 GTTGGCCTGA AGGGAGCTTA GAATGCAGCC CTACCTGGAG ATACCCAACT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGATAG GGTCCGCGCC GTGCGTGGTA CACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t