Transcript: Human NM_014858.4

Homo sapiens transmembrane and coiled-coil domain family 2 (TMCC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMCC2 (9911)
Length:
3968
CDS:
620..2749

Additional Resources:

NCBI RefSeq record:
NM_014858.4
NBCI Gene record:
TMCC2 (9911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431214 ACCGAGCAGATCAAGATTGAG pLKO_005 1517 CDS 100% 4.950 6.930 N TMCC2 n/a
2 TRCN0000127974 GAACGAGATGACGAACCTGAA pLKO.1 2350 CDS 100% 4.050 5.670 N TMCC2 n/a
3 TRCN0000422460 GAAGCAAGCCTCCTGATTTAA pLKO_005 804 CDS 100% 15.000 10.500 N Tmcc2 n/a
4 TRCN0000442685 CCGAAGCAAGCCTCCTGATTT pLKO_005 802 CDS 100% 13.200 9.240 N TMCC2 n/a
5 TRCN0000128931 CCTAAGTCCAATGCACTGTAT pLKO.1 2129 CDS 100% 4.950 3.465 N TMCC2 n/a
6 TRCN0000130626 CCTGACTGAGCTTCATCAGAA pLKO.1 2332 CDS 100% 4.950 3.465 N TMCC2 n/a
7 TRCN0000127687 GACGACAATGTGGCAGAGTAT pLKO.1 1550 CDS 100% 4.950 3.465 N TMCC2 n/a
8 TRCN0000130364 GCAAGTGTTCGAGAAGAAGAA pLKO.1 1618 CDS 100% 4.950 3.465 N TMCC2 n/a
9 TRCN0000127778 GTTTGGCAGTGCTGACAACAT pLKO.1 1924 CDS 100% 4.950 3.465 N TMCC2 n/a
10 TRCN0000127999 GCACCAGAAGATCCTGAAGAT pLKO.1 1495 CDS 100% 4.950 2.970 N TMCC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07509 pDONR223 100% 99.9% 100% None 945A>G;1200C>T n/a
2 ccsbBroad304_07509 pLX_304 0% 99.9% 100% V5 945A>G;1200C>T n/a
3 ccsbBroadEn_15683 pDONR223 0% 39.5% 29.2% None (many diffs) n/a
4 ccsbBroad304_15683 pLX_304 0% 39.5% 29.2% V5 (many diffs) n/a
5 TRCN0000465348 TAGGGTCCGCGCCGTGCGTGGTAC pLX_317 32.9% 39.5% 29.2% V5 (many diffs) n/a
Download CSV