Transcript: Mouse XM_006506734.3

PREDICTED: Mus musculus ATP/GTP binding protein-like 3 (Agbl3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agbl3 (76223)
Length:
2914
CDS:
524..2452

Additional Resources:

NCBI RefSeq record:
XM_006506734.3
NBCI Gene record:
Agbl3 (76223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422747 GACGGGATTTAAACCGTAATT pLKO_005 1776 CDS 100% 13.200 18.480 N AGBL3 n/a
2 TRCN0000031423 CCATACACTTACTCCAACCTT pLKO.1 1421 CDS 100% 3.000 4.200 N Agbl3 n/a
3 TRCN0000305105 ACGGGATTTAAACCGTAATTA pLKO_005 1777 CDS 100% 15.000 12.000 N Agbl3 n/a
4 TRCN0000031422 CCATAGTAGGAAACAGAATAT pLKO.1 1903 CDS 100% 13.200 10.560 N Agbl3 n/a
5 TRCN0000308932 CCATAGTAGGAAACAGAATAT pLKO_005 1903 CDS 100% 13.200 10.560 N Agbl3 n/a
6 TRCN0000305168 GAAAGGCTTCCTGGATTATAT pLKO_005 1642 CDS 100% 15.000 10.500 N Agbl3 n/a
7 TRCN0000305167 GCACACTCAGTGGTACTATTT pLKO_005 1132 CDS 100% 13.200 9.240 N Agbl3 n/a
8 TRCN0000031420 GCAAGGTTTGAGAGTGGTAAT pLKO.1 1040 CDS 100% 10.800 7.560 N Agbl3 n/a
9 TRCN0000031421 GCCTGGAAATAGAGCCTGTTT pLKO.1 876 CDS 100% 4.950 3.465 N Agbl3 n/a
10 TRCN0000331899 GCCTGGAAATAGAGCCTGTTT pLKO_005 876 CDS 100% 4.950 3.465 N Agbl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13597 pDONR223 100% 83.9% 84.7% None (many diffs) n/a
2 ccsbBroad304_13597 pLX_304 0% 83.9% 84.7% V5 (many diffs) n/a
3 TRCN0000465400 CCCAGAGACAACCCGCAAACTTCG pLX_317 21.8% 83.9% 84.7% V5 (many diffs) n/a
Download CSV