Construct: ORF TRCN0000465444
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019009.3_s317c1
- Derived from:
- ccsbBroadEn_14644
- DNA Barcode:
- TTTCCCTAACCATGTGAATACAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FLT3 (2322)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465444
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NM_004119.3 | 99.9% | 100% | 2979delG |
2 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NM_004119.2:c.2508_2510del | 99.8% | 99.8% | 2505_2506insATC;2976delG |
3 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535015.2 | 98% | 98% | 0_1ins57;2922delG |
4 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020486.1 | 92.7% | 92.7% | 740_741ins216;2763delG |
5 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535017.2 | 82.3% | 82.3% | 0_1ins525;2454delG |
6 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_011535018.2 | 82.3% | 82.3% | 0_1ins525;2454delG |
7 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020487.1 | 82.3% | 82.3% | 0_1ins525;2454delG |
8 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | NR_130706.2 | 75.2% | 1_66del;2274_2405del;3177_3958del | |
9 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020488.1 | 70.4% | 67.9% | 0_1ins803;77_78ins76;2100delG |
10 | human | 2322 | FLT3 | fms related tyrosine kinase 3 | XM_017020489.1 | 69.8% | 69.8% | 0_1ins897;2082delG |
11 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | NM_010229.2 | 82.5% | 85.4% | (many diffs) |
12 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | XM_006504804.3 | 51.6% | 53.1% | (many diffs) |
13 | mouse | 14255 | Flt3 | FMS-like tyrosine kinase 3 | XM_006504805.3 | 47.6% | 50.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 3048
- ORF length:
- 2979
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccggcgttg gcgcgcgacg gcggccagct gccgctgctc gttgtttttt 121 ctgcaatgat atttgggact attacaaatc aagatctgcc tgtgatcaag tgtgttttaa 181 tcaatcataa gaacaatgat tcatcagtgg ggaagtcatc atcatatccc atggtatcag 241 aatccccgga agacctcggg tgtgcgttga gaccccagag ctcagggaca gtgtacgaag 301 ctgccgctgt ggaagtggat gtatctgctt ccatcacact gcaagtgctg gtcgacgccc 361 cagggaacat ttcctgtctc tgggtcttta agcacagctc cctgaattgc cagccacatt 421 ttgatttaca aaacagagga gttgtttcca tggtcatttt gaaaatgaca gaaacccaag 481 ctggagaata cctacttttt attcagagtg aagctaccaa ttacacaata ttgtttacag 541 tgagtataag aaataccctg ctttacacat taagaagacc ttactttaga aaaatggaaa 601 accaggacgc cctggtctgc atatctgaga gcgttccaga gccgatcgtg gaatgggtgc 661 tttgcgattc acagggggaa agctgtaaag aagaaagtcc agctgttgtt aaaaaggagg 721 aaaaagtgct tcatgaatta tttgggacgg acataaggtg ctgtgccaga aatgaactgg 781 gcagggaatg caccaggctg ttcacaatag atctaaatca aactcctcag accacattgc 841 cacaattatt tcttaaagta ggggaaccct tatggataag gtgcaaagct gttcatgtga 901 accatggatt cgggctcacc tgggaattag aaaacaaagc actcgaggag ggcaactact 961 ttgagatgag tacctattca acaaacagaa ctatgatacg gattctgttt gcttttgtat 1021 catcagtggc aagaaacgac accggatact acacttgttc ctcttcaaag catcccagtc 1081 aatcagcttt ggttaccatc gtagaaaagg gatttataaa tgctaccaat tcaagtgaag 1141 attatgaaat tgaccaatat gaagagtttt gtttttctgt caggtttaaa gcctacccac 1201 aaatcagatg tacgtggacc ttctctcgaa aatcatttcc ttgtgagcaa aagggtcttg 1261 ataacggata cagcatatcc aagttttgca atcataagca ccagccagga gaatatatat 1321 tccatgcaga aaatgatgat gcccaattta ccaaaatgtt cacgctgaat ataagaagga 1381 aacctcaagt gctcgcagaa gcatcggcaa gtcaggcgtc ctgtttctcg gatggatacc 1441 cattaccatc ttggacctgg aagaagtgtt cagacaagtc tcccaactgc acagaagaga 1501 tcacagaagg agtctggaat agaaaggcta acagaaaagt gtttggacag tgggtgtcga 1561 gcagtactct aaacatgagt gaagccataa aagggttcct ggtcaagtgc tgtgcataca 1621 attcccttgg cacatcttgt gagacgatcc ttttaaactc tccaggcccc ttccctttca 1681 tccaagacaa catctcattc tatgcaacaa ttggtgtttg tctcctcttc attgtcgttt 1741 taaccctgct aatttgtcac aagtacaaaa agcaatttag gtatgaaagc cagctacaga 1801 tggtacaggt gaccggctcc tcagataatg agtacttcta cgttgatttc agagaatatg 1861 aatatgatct caaatgggag tttccaagag aaaatttaga gtttgggaag gtactaggat 1921 caggtgcttt tggaaaagtg atgaacgcaa cagcttatgg aattagcaaa acaggagtct 1981 caatccaggt tgccgtcaaa atgctgaaag aaaaagcaga cagctctgaa agagaggcac 2041 tcatgtcaga actcaagatg atgacccagc tgggaagcca cgagaatatt gtgaacctgc 2101 tgggggcgtg cacactgtca ggaccaattt acttgatttt tgaatactgt tgctatggtg 2161 atcttctcaa ctatctaaga agtaaaagag aaaaatttca caggacttgg acagagattt 2221 tcaaggaaca caatttcagt ttttacccca ctttccaatc acatccaaat tccagcatgc 2281 ctggttcaag agaagttcag atacacccgg actcggatca aatctcaggg cttcatggga 2341 attcatttca ctctgaagat gaaattgaat atgaaaacca aaaaaggctg gaagaagagg 2401 aggacttgaa tgtgcttaca tttgaagatc ttctttgctt tgcatatcaa gttgccaaag 2461 gaatggaatt tctggaattt aagtcgtgtg ttcacagaga cctggccgcc aggaacgtgc 2521 ttgtcaccca cgggaaagtg gtgaagatat gtgactttgg attggctcga gatatcatga 2581 gtgattccaa ctatgttgtc aggggcaatg cccgtctgcc tgtaaaatgg atggcccccg 2641 aaagcctgtt tgaaggcatc tacaccatta agagtgatgt ctggtcatat ggaatattac 2701 tgtgggaaat cttctcactt ggtgtgaatc cttaccctgg cattccggtt gatgctaact 2761 tctacaaact gattcaaaat ggatttaaaa tggatcagcc attttatgct acagaagaaa 2821 tatacattat aatgcaatCC TGCTGGGCTT TTGACTCAAG GAAACGGCCA TCCTTCCCTA 2881 ATTTGACTTC GTTTTTAGGA TGTCAGCTGG CAGATGCAGA AGAAGCGATG TATCAGAATG 2941 TGGATGGCCG TGTTTCGGAA TGTCCTCACA CCTACCAAAA CAGGCGACCT TTCAGCAGAG 3001 AGATGGATTT GGGGCTACTC TCTCCGCAGG CTCAGGTCGA AGATTCGCCA ACTTTCTTGT 3061 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 3121 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 3181 GAAAGGACGA TTTCCCTAAC CATGTGAATA CAGCACGCGT TAAGTCgaca atcaacctct 3241 ggattacaaa atttgtgaaa gatt