Transcript: Human XM_017020488.1

PREDICTED: Homo sapiens fms related tyrosine kinase 3 (FLT3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLT3 (2322)
Length:
3268
CDS:
728..2830

Additional Resources:

NCBI RefSeq record:
XM_017020488.1
NBCI Gene record:
FLT3 (2322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194748 CCAATTCAAGTGAAGATTATG pLKO.1 906 CDS 100% 13.200 18.480 N FLT3 n/a
2 TRCN0000378670 GGTGTCGAGCAGTACTCTAAA pLKO_005 1333 CDS 100% 13.200 18.480 N Flt3 n/a
3 TRCN0000039705 GCGATGTATCAGAATGTGGAT pLKO.1 2705 CDS 100% 2.640 3.696 N FLT3 n/a
4 TRCN0000039703 GCAATGATATTTGGGACTATT pLKO.1 109 5UTR 100% 13.200 10.560 N FLT3 n/a
5 TRCN0000197243 GCCTGTTTGAAGGCATCTACA pLKO.1 2424 CDS 100% 4.950 3.960 N FLT3 n/a
6 TRCN0000196764 GACTTGAATGTGCTTACATTT pLKO.1 2183 CDS 100% 1.320 1.056 N FLT3 n/a
7 TRCN0000196654 GTACCTGAAGTACAGTATATT pLKO.1 3107 3UTR 100% 0.000 0.000 N FLT3 n/a
8 TRCN0000195489 CAGACCACATTGCCACAATTA pLKO.1 684 5UTR 100% 13.200 9.240 N FLT3 n/a
9 TRCN0000039704 CCTGCTAATTTGTCACAAGTA pLKO.1 1525 CDS 100% 4.950 3.465 N FLT3 n/a
10 TRCN0000000775 CTGGAATTTAAGTCGTGTGTT pLKO.1 2252 CDS 100% 4.950 3.465 N FLT3 n/a
11 TRCN0000009887 GAAGAAGCGATGTATCAGAAT pLKO.1 2699 CDS 100% 4.950 3.465 N FLT3 n/a
12 TRCN0000000773 GCTAACTTCTACAAACTGATT pLKO.1 2534 CDS 100% 4.950 3.465 N FLT3 n/a
13 TRCN0000000774 CCACTTTCCAATCACATCCAA pLKO.1 2028 CDS 100% 3.000 2.100 N FLT3 n/a
14 TRCN0000009888 GAATTGTGTACCTGAAGTACA pLKO.1 3100 3UTR 100% 0.495 0.347 N FLT3 n/a
15 TRCN0000197014 GATAACGGATACAGCATATCC pLKO.1 1040 CDS 100% 0.495 0.347 N FLT3 n/a
16 TRCN0000009886 CAAGATCTGCCTGTGATCAAG pLKO.1 136 5UTR 100% 4.950 2.970 N FLT3 n/a
17 TRCN0000010546 GCATCCCAGTCAATCAGCTTT pLKO.1 850 CDS 100% 4.950 2.970 N FLT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06217 pDONR223 99.7% 70.4% 67.9% None 0_1ins803;77_78ins76 n/a
2 TRCN0000470643 TCAGGAAACTCATGCTAGATCGAG pLX_317 16.4% 70.4% 67.9% V5 0_1ins803;77_78ins76 n/a
3 ccsbBroadEn_14644 pDONR223 0% 70.4% 67.9% None 0_1ins803;77_78ins76 n/a
4 ccsbBroad304_14644 pLX_304 0% 70.4% 67.9% V5 0_1ins803;77_78ins76 n/a
5 TRCN0000465444 TTTCCCTAACCATGTGAATACAGC pLX_317 7.2% 70.4% 67.9% V5 0_1ins803;77_78ins76;2100delG n/a
6 TRCN0000487906 AGGTAGTCCCCCTCTAAAGGACGC pLX_317 9.3% 70.4% 67.9% V5 (not translated due to prior stop codon) 0_1ins803;77_78ins76 n/a
7 TRCN0000489221 CCCGCTTTCTAAAACTGGTAATCC pLX_317 11% 70.4% 67.9% V5 (not translated due to prior stop codon) 0_1ins803;77_78ins76 n/a
8 TRCN0000488279 TCCTTGCACTAACCTTCTTCTCTA pLX_317 10.3% 70.4% 67.8% V5 (not translated due to prior stop codon) 0_1ins803;77_78ins76;1624G>C n/a
9 TRCN0000488186 ATAGAGCGGTCCGTCAAAACTAGA pLX_317 11% 70.4% 67.8% V5 (not translated due to prior stop codon) 0_1ins803;77_78ins76;1108A>C n/a
10 TRCN0000487712 TTTGAATCTACGGTTTCAAGCTCA pLX_317 9.3% 70.4% 67.8% V5 (not translated due to prior stop codon) 0_1ins803;77_78ins76;1643A>T n/a
11 TRCN0000488315 ATGGATCTGATGTTACCCCCACTT pLX_317 17.3% 59.4% 59.4% V5 (not translated due to prior stop codon) 1_852del n/a
Download CSV