Transcript: Human XM_011535015.2

PREDICTED: Homo sapiens fms related tyrosine kinase 3 (FLT3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLT3 (2322)
Length:
3501
CDS:
139..3063

Additional Resources:

NCBI RefSeq record:
XM_011535015.2
NBCI Gene record:
FLT3 (2322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145134 AAAGCTGTTCATGTGAACCA pXPR_003 TGG 776 27% 7 1.0356 FLT3 FLT3 77350
2 BRDN0001149376 GTAACCAAAGCTGATTGACT pXPR_003 GGG 954 33% 8 0.5759 FLT3 FLT3 77349
3 BRDN0001145324 GGTGCTTTGCGATTCACAGG pXPR_003 GGG 547 19% 5 0.392 FLT3 FLT3 77348
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194748 CCAATTCAAGTGAAGATTATG pLKO.1 1139 CDS 100% 13.200 18.480 N FLT3 n/a
2 TRCN0000378670 GGTGTCGAGCAGTACTCTAAA pLKO_005 1566 CDS 100% 13.200 18.480 N Flt3 n/a
3 TRCN0000039705 GCGATGTATCAGAATGTGGAT pLKO.1 2938 CDS 100% 2.640 3.696 N FLT3 n/a
4 TRCN0000039703 GCAATGATATTTGGGACTATT pLKO.1 136 5UTR 100% 13.200 10.560 N FLT3 n/a
5 TRCN0000197243 GCCTGTTTGAAGGCATCTACA pLKO.1 2657 CDS 100% 4.950 3.960 N FLT3 n/a
6 TRCN0000196764 GACTTGAATGTGCTTACATTT pLKO.1 2416 CDS 100% 1.320 1.056 N FLT3 n/a
7 TRCN0000196654 GTACCTGAAGTACAGTATATT pLKO.1 3340 3UTR 100% 0.000 0.000 N FLT3 n/a
8 TRCN0000195489 CAGACCACATTGCCACAATTA pLKO.1 841 CDS 100% 13.200 9.240 N FLT3 n/a
9 TRCN0000039706 CCCTGCTTTACACATTAAGAA pLKO.1 569 CDS 100% 5.625 3.938 N FLT3 n/a
10 TRCN0000039704 CCTGCTAATTTGTCACAAGTA pLKO.1 1758 CDS 100% 4.950 3.465 N FLT3 n/a
11 TRCN0000000775 CTGGAATTTAAGTCGTGTGTT pLKO.1 2485 CDS 100% 4.950 3.465 N FLT3 n/a
12 TRCN0000009887 GAAGAAGCGATGTATCAGAAT pLKO.1 2932 CDS 100% 4.950 3.465 N FLT3 n/a
13 TRCN0000039707 GCAACTACTTTGAGATGAGTA pLKO.1 965 CDS 100% 4.950 3.465 N FLT3 n/a
14 TRCN0000000773 GCTAACTTCTACAAACTGATT pLKO.1 2767 CDS 100% 4.950 3.465 N FLT3 n/a
15 TRCN0000000774 CCACTTTCCAATCACATCCAA pLKO.1 2261 CDS 100% 3.000 2.100 N FLT3 n/a
16 TRCN0000009888 GAATTGTGTACCTGAAGTACA pLKO.1 3333 3UTR 100% 0.495 0.347 N FLT3 n/a
17 TRCN0000197014 GATAACGGATACAGCATATCC pLKO.1 1273 CDS 100% 0.495 0.347 N FLT3 n/a
18 TRCN0000009886 CAAGATCTGCCTGTGATCAAG pLKO.1 163 CDS 100% 4.950 2.970 N FLT3 n/a
19 TRCN0000010546 GCATCCCAGTCAATCAGCTTT pLKO.1 1083 CDS 100% 4.950 2.970 N FLT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14644 pDONR223 0% 98% 98% None 0_1ins57 n/a
2 ccsbBroad304_14644 pLX_304 0% 98% 98% V5 0_1ins57 n/a
3 TRCN0000465444 TTTCCCTAACCATGTGAATACAGC pLX_317 7.2% 98% 98% V5 0_1ins57;2922delG n/a
4 TRCN0000487906 AGGTAGTCCCCCTCTAAAGGACGC pLX_317 9.3% 98% 98% V5 (not translated due to prior stop codon) 0_1ins57;231C>T n/a
5 ccsbBroadEn_06217 pDONR223 99.7% 98% 97.9% None 0_1ins57;231C>T;623C>T n/a
6 TRCN0000470643 TCAGGAAACTCATGCTAGATCGAG pLX_317 16.4% 98% 97.9% V5 0_1ins57;231C>T;623C>T n/a
7 TRCN0000489221 CCCGCTTTCTAAAACTGGTAATCC pLX_317 11% 98% 97.9% V5 (not translated due to prior stop codon) 0_1ins57;231C>T;623C>T n/a
8 TRCN0000488279 TCCTTGCACTAACCTTCTTCTCTA pLX_317 10.3% 98% 97.9% V5 (not translated due to prior stop codon) 0_1ins57;231C>T;2446G>C n/a
9 TRCN0000488186 ATAGAGCGGTCCGTCAAAACTAGA pLX_317 11% 98% 97.9% V5 (not translated due to prior stop codon) 0_1ins57;231C>T;1930A>C n/a
10 TRCN0000487712 TTTGAATCTACGGTTTCAAGCTCA pLX_317 9.3% 98% 97.9% V5 (not translated due to prior stop codon) 0_1ins57;231C>T;2465A>T n/a
11 TRCN0000488315 ATGGATCTGATGTTACCCCCACTT pLX_317 17.3% 42.7% 42.7% V5 (not translated due to prior stop codon) 1_1674del n/a
Download CSV