Transcript: Human XM_011535017.2

PREDICTED: Homo sapiens fms related tyrosine kinase 3 (FLT3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLT3 (2322)
Length:
3404
CDS:
510..2966

Additional Resources:

NCBI RefSeq record:
XM_011535017.2
NBCI Gene record:
FLT3 (2322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194748 CCAATTCAAGTGAAGATTATG pLKO.1 1042 CDS 100% 13.200 18.480 N FLT3 n/a
2 TRCN0000378670 GGTGTCGAGCAGTACTCTAAA pLKO_005 1469 CDS 100% 13.200 18.480 N Flt3 n/a
3 TRCN0000039705 GCGATGTATCAGAATGTGGAT pLKO.1 2841 CDS 100% 2.640 3.696 N FLT3 n/a
4 TRCN0000197243 GCCTGTTTGAAGGCATCTACA pLKO.1 2560 CDS 100% 4.950 3.960 N FLT3 n/a
5 TRCN0000196764 GACTTGAATGTGCTTACATTT pLKO.1 2319 CDS 100% 1.320 1.056 N FLT3 n/a
6 TRCN0000196654 GTACCTGAAGTACAGTATATT pLKO.1 3243 3UTR 100% 0.000 0.000 N FLT3 n/a
7 TRCN0000195489 CAGACCACATTGCCACAATTA pLKO.1 744 CDS 100% 13.200 9.240 N FLT3 n/a
8 TRCN0000039706 CCCTGCTTTACACATTAAGAA pLKO.1 472 5UTR 100% 5.625 3.938 N FLT3 n/a
9 TRCN0000039704 CCTGCTAATTTGTCACAAGTA pLKO.1 1661 CDS 100% 4.950 3.465 N FLT3 n/a
10 TRCN0000000775 CTGGAATTTAAGTCGTGTGTT pLKO.1 2388 CDS 100% 4.950 3.465 N FLT3 n/a
11 TRCN0000009887 GAAGAAGCGATGTATCAGAAT pLKO.1 2835 CDS 100% 4.950 3.465 N FLT3 n/a
12 TRCN0000039707 GCAACTACTTTGAGATGAGTA pLKO.1 868 CDS 100% 4.950 3.465 N FLT3 n/a
13 TRCN0000000773 GCTAACTTCTACAAACTGATT pLKO.1 2670 CDS 100% 4.950 3.465 N FLT3 n/a
14 TRCN0000000774 CCACTTTCCAATCACATCCAA pLKO.1 2164 CDS 100% 3.000 2.100 N FLT3 n/a
15 TRCN0000009888 GAATTGTGTACCTGAAGTACA pLKO.1 3236 3UTR 100% 0.495 0.347 N FLT3 n/a
16 TRCN0000197014 GATAACGGATACAGCATATCC pLKO.1 1176 CDS 100% 0.495 0.347 N FLT3 n/a
17 TRCN0000010546 GCATCCCAGTCAATCAGCTTT pLKO.1 986 CDS 100% 4.950 2.970 N FLT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14644 pDONR223 0% 82.3% 82.3% None 0_1ins525 n/a
2 ccsbBroad304_14644 pLX_304 0% 82.3% 82.3% V5 0_1ins525 n/a
3 TRCN0000465444 TTTCCCTAACCATGTGAATACAGC pLX_317 7.2% 82.3% 82.3% V5 0_1ins525;2454delG n/a
4 TRCN0000487906 AGGTAGTCCCCCTCTAAAGGACGC pLX_317 9.3% 82.3% 82.3% V5 (not translated due to prior stop codon) 0_1ins525 n/a
5 ccsbBroadEn_06217 pDONR223 99.7% 82.3% 82.2% None 0_1ins525;155C>T n/a
6 TRCN0000470643 TCAGGAAACTCATGCTAGATCGAG pLX_317 16.4% 82.3% 82.2% V5 0_1ins525;155C>T n/a
7 TRCN0000489221 CCCGCTTTCTAAAACTGGTAATCC pLX_317 11% 82.3% 82.2% V5 (not translated due to prior stop codon) 0_1ins525;155C>T n/a
8 TRCN0000488279 TCCTTGCACTAACCTTCTTCTCTA pLX_317 10.3% 82.3% 82.2% V5 (not translated due to prior stop codon) 0_1ins525;1978G>C n/a
9 TRCN0000488186 ATAGAGCGGTCCGTCAAAACTAGA pLX_317 11% 82.3% 82.2% V5 (not translated due to prior stop codon) 0_1ins525;1462A>C n/a
10 TRCN0000487712 TTTGAATCTACGGTTTCAAGCTCA pLX_317 9.3% 82.3% 82.2% V5 (not translated due to prior stop codon) 0_1ins525;1997A>T n/a
11 TRCN0000488315 ATGGATCTGATGTTACCCCCACTT pLX_317 17.3% 50.8% 50.8% V5 (not translated due to prior stop codon) 1_1206del n/a
Download CSV