Construct: ORF TRCN0000465536
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005316.1_s317c1
- Derived from:
- ccsbBroadEn_11396
- DNA Barcode:
- TCAAGTTTGCTTCTAAAAGTAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF10 (9639)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465536
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | XM_011534770.2 | 32% | 31.4% | (many diffs) |
| 2 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | XM_011534768.1 | 28.6% | 28% | (many diffs) |
| 3 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | XM_011534767.2 | 28.5% | 28% | (many diffs) |
| 4 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | NM_001308152.2 | 28.5% | 28% | (many diffs) |
| 5 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | NM_014629.4 | 27.7% | 27.2% | (many diffs) |
| 6 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | XM_005266041.4 | 27.7% | 27.2% | (many diffs) |
| 7 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | XM_024447334.1 | 27.7% | 27.2% | (many diffs) |
| 8 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | XM_017014003.1 | 27.2% | 26.7% | (many diffs) |
| 9 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | NM_001308153.2 | 27.1% | 26.6% | (many diffs) |
| 10 | human | 9639 | ARHGEF10 | Rho guanine nucleotide exch... | XM_024447335.1 | 27.1% | 26.6% | (many diffs) |
| 11 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | NM_001037736.2 | 24.4% | 25.2% | (many diffs) |
| 12 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_017312672.1 | 23.9% | 24.8% | (many diffs) |
| 13 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | NM_172751.3 | 23.7% | 24.5% | (many diffs) |
| 14 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_017312670.1 | 23.2% | 24.1% | (many diffs) |
| 15 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_017312671.1 | 23.2% | 24.1% | (many diffs) |
| 16 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_006508772.3 | 23% | 23.8% | (many diffs) |
| 17 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_006508770.3 | 23% | 23.8% | (many diffs) |
| 18 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_006508771.3 | 23% | 23.8% | (many diffs) |
| 19 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_017312673.1 | 23% | 23.8% | (many diffs) |
| 20 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_017312668.1 | 22.6% | 23.4% | (many diffs) |
| 21 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_006508768.3 | 22.6% | 23.4% | (many diffs) |
| 22 | mouse | 234094 | Arhgef10 | Rho guanine nucleotide exch... | XM_017312669.1 | 21.7% | 22.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1206
- ORF length:
- 1140
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaatccagaa gaagcaattt acgatgacgt tccaagggaa aactcagact 121 ctgaaccaga tgaaatgatt tatgatgatg ttgagaatgg ggatgaaggt ggaaacagct 181 ccttggaata cggatggagt tcgagtgaat ttgaaagtta cgaagagcag agtgactcgg 241 agtgcaagaa tgggattccc aggtccttcc tgcgcagcaa ccacaaaaag caaatgcaga 301 agctcgtgaa ggccgcgaag gacggcacca aggacgggct ggagaggacc agggcagccg 361 tgaagagggg ccgctccttc atcaggacca agtctctcat cgcacaggat cacagatctt 421 ctcttgagga agaacagaat ttgttcattg atgttgactg caagcacccg gaagccatct 481 tgaccccgat gcccgagggt ttatctcagc agcaggttgt aagaagatat atactgggtt 541 cagttgtcga cagtgaaaag aactacgtag atgctcttaa gaggattttg gagcaatatg 601 agaagccgct gtctgagatg gagccaaagg ttctgagtga gaggaagctg aagacggtgt 661 tctaccgagt caaagagatc ctgcagtgcc actcgctatt tcagatcgcg ctggccagcc 721 gcgtttccga gtgggactcc gtggaaatga taggcgttgt cttcgtggct tcgttttcta 781 agtccatggt gctggatgca tacagtgaat atgtgaacaa tttcagcaca gccgtggcag 841 tcctcaagaa aacatgtgcc acaaagcccg cttttcttga attTTTAAAG CAGGAACAGG 901 AGGCCAGCCC CGATCGAACC ACGCTCTACA GCCTGATGAT GAAGCCCATC CAGAGGTTCC 961 CACAGTTCAT CCTCCTGCTC CAGGACATGC TGAAGAACAC CTCCAAAGGC CACCCCGACA 1021 GGCTGCCTCT TCAGATGGCC CTGACAGAGC TCGAAACACT AGCAGAGAAG TTAAATGAAA 1081 GAAAGAGAGA TGCTGATCAA CGCTGTGAAG TGAAGCAAAT AGCCAAAGCC ATAAACGAAA 1141 GATACCTGAA CAAGGTTGAG AGAGGTTTTC TTCAACTCTA TTCCAAAATT ATTTTTGCTT 1201 TGTGCTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1261 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1321 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATCAAGTTTG CTTCTAAAAG TAATTACGCG 1381 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt