Transcript: Mouse NM_172751.3

Mus musculus Rho guanine nucleotide exchange factor (GEF) 10 (Arhgef10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Arhgef10 (234094)
Length:
5541
CDS:
236..4273

Additional Resources:

NCBI RefSeq record:
NM_172751.3
NBCI Gene record:
Arhgef10 (234094)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432679 CGTCATCTCCAGACGCGAATA pLKO_005 552 CDS 100% 10.800 15.120 N Arhgef10 n/a
2 TRCN0000113373 CGAGGGAGCTATCAGAACTTA pLKO.1 2483 CDS 100% 5.625 7.875 N Arhgef10 n/a
3 TRCN0000113374 CCCTAGGATTGCCAACTCAAA pLKO.1 3972 CDS 100% 4.950 6.930 N Arhgef10 n/a
4 TRCN0000113371 GCGAAATCAAACAAATAGCAA pLKO.1 2010 CDS 100% 3.000 4.200 N Arhgef10 n/a
5 TRCN0000438554 TAGATGCTCTCCGGAGGATTT pLKO_005 1473 CDS 100% 10.800 8.640 N Arhgef10 n/a
6 TRCN0000113370 CCCATCATTCACCTGATACAT pLKO.1 4529 3UTR 100% 5.625 3.938 N Arhgef10 n/a
7 TRCN0000113372 CCTGAACCTTACCTGAGCAAT pLKO.1 2870 CDS 100% 4.950 3.465 N Arhgef10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11396 pDONR223 100% 23.7% 24.5% None (many diffs) n/a
2 ccsbBroad304_11396 pLX_304 0% 23.7% 24.5% V5 (many diffs) n/a
3 TRCN0000465536 TCAAGTTTGCTTCTAAAAGTAATT pLX_317 28.7% 23.7% 24.5% V5 (many diffs) n/a
Download CSV