Transcript: Human XM_011534767.2

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 10 (ARHGEF10), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF10 (9639)
Length:
5150
CDS:
48..3965

Additional Resources:

NCBI RefSeq record:
XM_011534767.2
NBCI Gene record:
ARHGEF10 (9639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047458 CGCCGAGTCTTCATGTTAAAT pLKO.1 1845 CDS 100% 15.000 21.000 N ARHGEF10 n/a
2 TRCN0000298875 CGCCGAGTCTTCATGTTAAAT pLKO_005 1845 CDS 100% 15.000 21.000 N ARHGEF10 n/a
3 TRCN0000047461 CGCGAAACCAAACAAAGTTTA pLKO.1 2063 CDS 100% 13.200 18.480 N ARHGEF10 n/a
4 TRCN0000298950 CGCGAAACCAAACAAAGTTTA pLKO_005 2063 CDS 100% 13.200 18.480 N ARHGEF10 n/a
5 TRCN0000047459 CGGATGGAGTTCGAGTGAATT pLKO.1 788 CDS 100% 0.000 0.000 N ARHGEF10 n/a
6 TRCN0000298948 CGGATGGAGTTCGAGTGAATT pLKO_005 788 CDS 100% 0.000 0.000 N ARHGEF10 n/a
7 TRCN0000047460 CCTGAACCTTACCTAAATAAT pLKO.1 2562 CDS 100% 15.000 10.500 N ARHGEF10 n/a
8 TRCN0000298876 CCTGAACCTTACCTAAATAAT pLKO_005 2562 CDS 100% 15.000 10.500 N ARHGEF10 n/a
9 TRCN0000047462 GCACGAGAAAGACAAGGACAA pLKO.1 3518 CDS 100% 4.050 2.835 N ARHGEF10 n/a
10 TRCN0000298947 GCACGAGAAAGACAAGGACAA pLKO_005 3518 CDS 100% 4.050 2.835 N ARHGEF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11396 pDONR223 100% 28.5% 28% None (many diffs) n/a
2 ccsbBroad304_11396 pLX_304 0% 28.5% 28% V5 (many diffs) n/a
3 TRCN0000465536 TCAAGTTTGCTTCTAAAAGTAATT pLX_317 28.7% 28.5% 28% V5 (many diffs) n/a
Download CSV