Construct: ORF TRCN0000465568
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017482.1_s317c1
- Derived from:
- ccsbBroadEn_09759
- DNA Barcode:
- ACTTCCTGGAGAGGGGCTAACAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WBP2NL (164684)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465568
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 164684 | WBP2NL | WBP2 N-terminal like | NM_152613.3 | 99.7% | 99.3% | 362A>G;855G>C |
| 2 | human | 164684 | WBP2NL | WBP2 N-terminal like | XR_430402.2 | 56.7% | (many diffs) | |
| 3 | human | 164684 | WBP2NL | WBP2 N-terminal like | XR_244353.5 | 18.2% | (many diffs) | |
| 4 | human | 164684 | WBP2NL | WBP2 N-terminal like | XR_937829.3 | 18.1% | (many diffs) | |
| 5 | human | 164684 | WBP2NL | WBP2 N-terminal like | XR_937827.3 | 16.4% | (many diffs) | |
| 6 | human | 164684 | WBP2NL | WBP2 N-terminal like | XR_937830.3 | 15.9% | (many diffs) | |
| 7 | human | 164684 | WBP2NL | WBP2 N-terminal like | XR_244354.5 | 15.6% | (many diffs) | |
| 8 | human | 164684 | WBP2NL | WBP2 N-terminal like | XR_937828.3 | 14.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 993
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggtgaatcag agccacaccg agaaccgccg cggagccctc atccctaacg 121 gtgaaagtct cttgaagcgg tctccgaatg tggagctctc cttcccacag cgatcagaag 181 gctcaaatgt ctttagtggt agaaagacag gaacattgtt tctcacttca taccgggtga 241 ttttcataac ttcatgctcc atcagtgatc ccatgttgtc ttttatgatg ccatttgatc 301 tgatgacgaa cctcactgtt gaacaaccag tatttgctgc aaacttcatt aagggaacta 361 ttcaggcagc tccatatggt ggctgggaag gacaagctac ttttaaatta gtcttcagaa 421 atggaggtgc cattgaattt gcccagttga tggtgaaagc tgcctctgct gctgcccgag 481 gatttccact tagaacctta aatgactggt tcagctctat gggaatttat gtaattactg 541 gggaagggaa tatgtgcact ccacagatgc cttgttcagt tattgtctat ggagccccac 601 ctgcaggata tggagcccca cctcccggat acggagcccc acctgcagga tatggagccc 661 aacccgtagg aaatgaaggc ccgcctgtgg gatacagagc ctcacctgtg cgatatggag 721 ccccacctct tGGATACGGA GCCCCACCTG CAGGATATGG AGCCCCACCT CTAGGATATG 781 GAGCCCCACC TCTTGGATAT GGAACCCCAC CTCTCGGATA TGGAGCCCCA CCTCTCGGAT 841 ATGGAGCCCC ACCTGCAGGA AATGAAGGCC CGCCTGCGGG ATACAGAGCC TCACCTGCTG 901 GATCAGGAGC CAGGCCTCAC GAATCTACAG CAGCCCAGGC TCCTGAAAAC GAGGCTTCTC 961 TTCCCTCTGC CTCCTCTTCT CAGGTCCATT CTTACCCAAC TTTCTTGTAC AAAGTGGTTG 1021 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1081 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAC 1141 TTCCTGGAGA GGGGCTAACA GTACGCGTTA AGTCgacaat caacctctgg attacaaaat 1201 ttgtgaaaga tt