Transcript: Human XR_244353.5

PREDICTED: Homo sapiens WBP2 N-terminal like (WBP2NL), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WBP2NL (164684)
Length:
5058
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244353.5
NBCI Gene record:
WBP2NL (164684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244353.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139246 CCCGAGGATTTCCACTTAGAA pLKO.1 4126 3UTR 100% 5.625 7.875 N WBP2NL n/a
2 TRCN0000140342 CCCTAACGGTGAAAGTCTCTT pLKO.1 3764 3UTR 100% 4.950 6.930 N WBP2NL n/a
3 TRCN0000122766 CTCACTTCATACCGGGTGATT pLKO.1 3873 3UTR 100% 4.950 6.930 N WBP2NL n/a
4 TRCN0000144528 CAGATGCCTTGTTCAGTTATT pLKO.1 4215 3UTR 100% 13.200 9.240 N WBP2NL n/a
5 TRCN0000139558 CAGCGATCAGAAGGCTCAAAT pLKO.1 3819 3UTR 100% 13.200 9.240 N WBP2NL n/a
6 TRCN0000139933 GCGATCAGAAGGCTCAAATGT pLKO.1 3821 3UTR 100% 5.625 3.938 N WBP2NL n/a
7 TRCN0000139307 CTGATGACGAACCTCACTGTT pLKO.1 3951 3UTR 100% 4.950 3.465 N WBP2NL n/a
8 TRCN0000143390 GAATATGTGCACTCCACAGAT pLKO.1 4199 3UTR 100% 4.950 3.465 N WBP2NL n/a
9 TRCN0000139058 CTGGTTCAGCTCTATGGGAAT pLKO.1 4157 3UTR 100% 4.050 2.835 N WBP2NL n/a
10 TRCN0000139479 CCAAGCAAAGAGGTACCCTAA pLKO.1 4676 3UTR 100% 0.000 0.000 N WBP2NL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244353.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09759 pDONR223 100% 18.2% None (many diffs) n/a
2 ccsbBroad304_09759 pLX_304 0% 18.2% V5 (many diffs) n/a
3 TRCN0000465568 ACTTCCTGGAGAGGGGCTAACAGT pLX_317 28.7% 18.2% V5 (many diffs) n/a
4 TRCN0000467361 GTAATTTTTGTGACGAGATGCGTT pLX_317 71% 11.8% V5 (not translated due to prior stop codon) 1_3716del;4078A>G;4318_5058del n/a
5 ccsbBroadEn_16117 pDONR223 0% 11.8% None (many diffs) n/a
6 ccsbBroad304_16117 pLX_304 0% 11.8% V5 (many diffs) n/a
Download CSV