Construct: ORF TRCN0000465748
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005304.1_s317c1
- Derived from:
- ccsbBroadEn_03326
- DNA Barcode:
- CGGTTCTCTACCTAGACCACAACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OSER1 (51526)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465748
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51526 | OSER1 | oxidative stress responsive... | NM_016470.8 | 100% | 100% | |
2 | human | 51526 | OSER1 | oxidative stress responsive... | XM_011528853.3 | 100% | 100% | |
3 | human | 51526 | OSER1 | oxidative stress responsive... | XM_017027873.1 | 100% | 100% | |
4 | human | 51526 | OSER1 | oxidative stress responsive... | XM_024451891.1 | 100% | 100% | |
5 | human | 51526 | OSER1 | oxidative stress responsive... | XM_011528854.3 | 86.9% | 86.9% | 75_76ins114 |
6 | mouse | 66680 | Oser1 | oxidative stress responsive... | NM_025699.2 | 87.7% | 86.6% | (many diffs) |
7 | mouse | 66680 | Oser1 | oxidative stress responsive... | XM_006500025.1 | 87.7% | 86.6% | (many diffs) |
8 | mouse | 66680 | Oser1 | oxidative stress responsive... | XM_006500026.2 | 87.7% | 86.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 942
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa atccgaagcc aaggatggag aggaggagag tctacagact gctttcaaaa 121 aattaagagt ggatgcatca gggtctgtag catctctgtc tgttggagaa ggcacaggtg 181 tcagagcacc agtcagaaca gcaacagatg ataccaaacc taaaaccaca tgtgcatcta 241 aagacagttg gcacgggtct acaaggaagt cttcacgagg agcagtgaga actcagcgtc 301 gtcgacgttc taagtctcct gtccttcatc ctccaaagtt tatacattgc agtacaatag 361 cgtcttcttc cagcagtcaa ctcaagcaca aaagccagac tgactcacct gatggcagca 421 gtgggctggg aatttcatcc cctaaagagt tcagtgcagg agaaagctct acttctctcg 481 atgctaatca cacaggggca gtcgttgagc ctttgagaac ttctgttcca aggctcccat 541 cagagagtaa gaaggaagac tccTCTGACG CTACCCAAGT CCCCCAAGCA AGTCTCAAAG 601 CCAGTGATCT CTCTGACTTT CAATCAGTTT CCAAGCTAAA CCAGGGCAAG CCATGCACAT 661 GCATAGGCAA GGAATGCCAG TGTAAGAGAT GGCATGATAT GGAAGTGTAT TCCTTTTCAG 721 GCCTGCAGAG TGTCCCTCCC TTGGCTCCAG AACGAAGATC CACACTTGAG GACTACTCTC 781 AGTCGCTGCA CGCCAGAACT CTGTCTGGCT CTCCCCGATC CTGTTCTGAG CAAGCTCGAG 841 TCTTCGTGGA TGATGTGACC ATTGAGGACC TGTCAGGCTA CATGGAGTAT TACTTGTATA 901 TTCCCAAGAA AATGTCCCAC ATGGCAGAAA TGATGTACAC CTGCCCAACT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGACGG TTCTCTACCT AGACCACAAC CACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t